ID: 1192789759

View in Genome Browser
Species Human (GRCh38)
Location X:74369821-74369843
Sequence CAGATTAAGTAGCTGGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192789756_1192789759 -1 Left 1192789756 X:74369799-74369821 CCCTGTTTCTTCAATTAAGCAAC No data
Right 1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG No data
1192789757_1192789759 -2 Left 1192789757 X:74369800-74369822 CCTGTTTCTTCAATTAAGCAACA No data
Right 1192789759 X:74369821-74369843 CAGATTAAGTAGCTGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192789759 Original CRISPR CAGATTAAGTAGCTGGCTTC TGG Intergenic
No off target data available for this crispr