ID: 1192792359

View in Genome Browser
Species Human (GRCh38)
Location X:74394990-74395012
Sequence TGTAATAATAGCCATGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192792359_1192792363 7 Left 1192792359 X:74394990-74395012 CCCAGCCCATGGCTATTATTACA No data
Right 1192792363 X:74395020-74395042 AAAATAATAATAACAGATTCTGG No data
1192792359_1192792365 27 Left 1192792359 X:74394990-74395012 CCCAGCCCATGGCTATTATTACA No data
Right 1192792365 X:74395040-74395062 TGGTGAGGTTGCAGAAATAAAGG No data
1192792359_1192792364 12 Left 1192792359 X:74394990-74395012 CCCAGCCCATGGCTATTATTACA No data
Right 1192792364 X:74395025-74395047 AATAATAACAGATTCTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192792359 Original CRISPR TGTAATAATAGCCATGGGCT GGG (reversed) Intergenic
No off target data available for this crispr