ID: 1192793302

View in Genome Browser
Species Human (GRCh38)
Location X:74405735-74405757
Sequence AGGGAGAGTGCAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192793293_1192793302 27 Left 1192793293 X:74405685-74405707 CCCCTGGCAGTGACAGTATGGTG No data
Right 1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG No data
1192793295_1192793302 25 Left 1192793295 X:74405687-74405709 CCTGGCAGTGACAGTATGGTGTG No data
Right 1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG No data
1192793294_1192793302 26 Left 1192793294 X:74405686-74405708 CCCTGGCAGTGACAGTATGGTGT No data
Right 1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192793302 Original CRISPR AGGGAGAGTGCAGTGATTGT GGG Intergenic