ID: 1192797963

View in Genome Browser
Species Human (GRCh38)
Location X:74440159-74440181
Sequence AGGGTTTTAGAGAGGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 306}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192797958_1192797963 -6 Left 1192797958 X:74440142-74440164 CCATGACCAGGGTGAGGAGGGTT 0: 1
1: 0
2: 2
3: 20
4: 176
Right 1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG 0: 1
1: 0
2: 0
3: 28
4: 306
1192797954_1192797963 -1 Left 1192797954 X:74440137-74440159 CCCAGCCATGACCAGGGTGAGGA 0: 1
1: 0
2: 0
3: 27
4: 244
Right 1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG 0: 1
1: 0
2: 0
3: 28
4: 306
1192797955_1192797963 -2 Left 1192797955 X:74440138-74440160 CCAGCCATGACCAGGGTGAGGAG 0: 1
1: 1
2: 1
3: 25
4: 230
Right 1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG 0: 1
1: 0
2: 0
3: 28
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192797963 Original CRISPR AGGGTTTTAGAGAGGGAGTA GGG Intronic
901247392 1:7743420-7743442 AGTGTTCTAGAAAGGGACTATGG - Intronic
902433274 1:16380140-16380162 AGGGTTTTAGAAAGTGACTGTGG + Intronic
902795704 1:18799356-18799378 AAGGATTAAGACAGGGAGTAGGG + Intergenic
903723268 1:25421759-25421781 AGGGATGTAGGGAGGGAGGAAGG + Intronic
903985785 1:27227233-27227255 AGGATTTTAGAGAAGGAACAGGG + Intergenic
904984514 1:34533912-34533934 AAGGCTTTAGAGAGGCAATAAGG - Intergenic
905686108 1:39909606-39909628 GGAGTTTCAGAGAGGGAGAAGGG - Intergenic
906480401 1:46195762-46195784 AGGGTTGGAGCTAGGGAGTAGGG + Intronic
909076104 1:71052473-71052495 AGGGCTTGACAGAGGGAGTTTGG + Intergenic
909690116 1:78397933-78397955 AGGGATCTAGAGAGGCAGTCTGG + Intronic
909932880 1:81518074-81518096 AGGTTTTTAGCGAGGAAGGATGG + Intronic
911335722 1:96577756-96577778 ATTGTTTTAGACAGAGAGTAAGG + Intergenic
912364094 1:109118692-109118714 AGGATTTTGGAGTGGGAGAATGG + Intronic
913231899 1:116746878-116746900 AAGGTTTAGGAGAGGGAGGAGGG - Intergenic
913408879 1:118528149-118528171 AGGGAGTTAGAGAGAGAGTGGGG + Intergenic
915061348 1:153188412-153188434 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
915239515 1:154510080-154510102 TGTGCTTTAGAGAAGGAGTAGGG + Intronic
915342271 1:155183209-155183231 AGGGTGTTAAATAGGGAGTTGGG - Intronic
915649103 1:157294659-157294681 AGGAATTTAGAGAGGTAGTCTGG - Intergenic
915944977 1:160142953-160142975 AAAGTGTTAGATAGGGAGTAAGG - Exonic
917276895 1:173340723-173340745 AGGGTTTTAGAATGGGAATGAGG + Intergenic
917981095 1:180269899-180269921 AGGGCTTCAGGGAGGGAGTTGGG + Intronic
918772247 1:188576227-188576249 ATGTTTTTAGAAAGTGAGTAGGG - Intergenic
918802008 1:188984792-188984814 AGGGTGGGAGAGAGGGAGGAAGG - Intergenic
919121675 1:193348838-193348860 AAGCTTTTAGAGAGGCAGTGTGG + Intergenic
920445701 1:206014544-206014566 GTGGTTTTACAGAGGGAGTGGGG + Intronic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922470181 1:225871910-225871932 ATGGTTTTGGGGAGGGAGCAGGG - Intronic
923066940 1:230526973-230526995 AGGAATCTAGAGAGGGAGTCTGG + Intergenic
1064232801 10:13544278-13544300 AGGGGTAGAGAGAGGGATTACGG + Intergenic
1064863114 10:19848806-19848828 AGGGTTTTGGAAGGGGAGGATGG + Intronic
1066289888 10:34004270-34004292 AGGGTTTTGGAGTTGGAGGAAGG - Intergenic
1068751260 10:60595321-60595343 AGGGTTTTTGAAAGAGAGTTTGG + Intronic
1069940340 10:71951140-71951162 AGGGTCTTATAGAGGTAGTCGGG + Intergenic
1070560353 10:77561766-77561788 AGGGTTTCAGAGAAGGGATAAGG + Intronic
1070656261 10:78273715-78273737 AGGGTGTTAGACATGGAGTCAGG + Intergenic
1073643542 10:105276713-105276735 AGGGTTTTAGAGAATGAAGATGG - Intergenic
1073694895 10:105853783-105853805 AAGGCTTTAGAGAAGAAGTAGGG + Intergenic
1074200842 10:111233867-111233889 GGGGTTTGGGAAAGGGAGTATGG + Intergenic
1075147154 10:119892291-119892313 TGGGTTTTGGAGAGGGTGTTTGG + Intronic
1075971191 10:126654915-126654937 AGGGCTTAAGAGAGGGAGAGAGG + Intronic
1076926469 10:133491567-133491589 ATGGTTTGAGGGAGGGATTATGG - Intergenic
1077761046 11:5098596-5098618 AGTTATTTAGAGAGGAAGTAAGG - Intergenic
1079657660 11:23002612-23002634 AGGGTTTTACAGAGATAGTTTGG - Intergenic
1079957196 11:26880187-26880209 AGGGAGTAAGAGAGGGAGAAGGG + Intergenic
1080302073 11:30795761-30795783 AGGATTATAGAGATGCAGTATGG - Intergenic
1080467492 11:32511407-32511429 AGGATTCCAGAGAGGGAGGAGGG + Intergenic
1081322568 11:41708927-41708949 AGGGTTTTTGATAGGCAGTGGGG + Intergenic
1081557199 11:44175786-44175808 AGGGATGGAGAGAGGGAGAAAGG + Intronic
1081717431 11:45260430-45260452 AGGGGTTGAGAGAGGGAGCCTGG + Intronic
1082962998 11:58936943-58936965 AAGCTTTTAGAGAGGAAGAAGGG - Intronic
1083516199 11:63261521-63261543 AGGAATCTAGAGAGGCAGTATGG + Intronic
1084971639 11:72775336-72775358 AAGGTTTTAGACAGGGAGACTGG - Intronic
1085262901 11:75218477-75218499 AGGCCTTTAGAGAGGGACTCTGG + Intergenic
1087427797 11:98012820-98012842 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1087695274 11:101369513-101369535 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
1090339105 11:125999783-125999805 AGGATGTTAGAGAAGGAGAAGGG - Intronic
1091320282 11:134644698-134644720 AGCGTGGTAGAGAGGGTGTAAGG - Intergenic
1092770840 12:11895022-11895044 TGGGTTTTAGGGAGGGATTATGG - Exonic
1093671949 12:21886959-21886981 AGGGTATTAGAGAGTGAATTGGG - Intronic
1093774747 12:23060328-23060350 AGGCTTTTATAGAGTCAGTATGG - Intergenic
1093784497 12:23176586-23176608 AGGGTTTTAGAAAGGCAATTTGG + Intergenic
1093920674 12:24856187-24856209 GGGGTTTTACAGTGGGAGAAAGG - Intronic
1093976490 12:25427552-25427574 AGGGTTTAAGAGCAGGGGTAGGG - Intronic
1095230479 12:39733610-39733632 AGGAATTTAGAGAGGCAGTCTGG + Intronic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1097930364 12:65177257-65177279 AGGGTTGGAGGGAAGGAGTAGGG + Intronic
1100276120 12:93073438-93073460 AGGGTTTTAGAGATGGATGGTGG - Intergenic
1100276130 12:93073482-93073504 AGGGTTTTAGAGACGGATGGTGG - Intergenic
1100276140 12:93073526-93073548 AGGGTTTTAGAGACGGATGGTGG - Intergenic
1100375569 12:94013209-94013231 AGGGAGGGAGAGAGGGAGTAAGG + Intergenic
1101483166 12:105122853-105122875 AGGCTTGAAGAGAGGGAGAAAGG - Intronic
1101775310 12:107788156-107788178 TGGGTGGTAGAGAGGGAGCAAGG - Intergenic
1101906174 12:108828145-108828167 AGGGTTTACAAGAGGGAGGAGGG + Intronic
1105456063 13:20542289-20542311 AGGGTTTAAGAGAAGAAATAAGG + Intergenic
1105907934 13:24832711-24832733 AGGGTTTTAGATAGGGGGATTGG + Intronic
1106777773 13:33025203-33025225 AGCGTTTTGGGGAGGTAGTACGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1107327589 13:39261690-39261712 AGGGTGTTAGTGAGAGAGGAGGG - Intergenic
1110244825 13:73310908-73310930 AGGGTTTGGGAGAGAGAGTGAGG + Intergenic
1110348079 13:74471830-74471852 AGAGTTTTAGAGAGAAATTACGG + Intergenic
1110428063 13:75391753-75391775 AGGAGCTCAGAGAGGGAGTAGGG - Intronic
1111959279 13:94792033-94792055 AGAGTTTTAAGGAGGGAGAAGGG + Intergenic
1112372917 13:98810714-98810736 AGGGATTTAGTGATGGAGTGTGG + Intronic
1113084903 13:106558902-106558924 AGGGTTTAGGGGAGGGAGTGAGG + Intronic
1114844911 14:26309346-26309368 AGGAATCTAGAGAGGCAGTATGG - Intergenic
1114894460 14:26969778-26969800 AGGCTTTGAGAGAGTGAGCATGG + Intergenic
1115594752 14:34898648-34898670 AGGTTGTTAGAGAAGGAGCACGG + Intergenic
1117719874 14:58618952-58618974 AGGGTCTTATGGAGGGAGGAGGG + Intergenic
1117799265 14:59426764-59426786 AGGATTTTAGGCAGGGAGCAGGG - Intergenic
1118516065 14:66530154-66530176 AGGATTCTAGAGAGGCAGTCTGG + Intronic
1119920895 14:78444951-78444973 AGTGTTTGAGTAAGGGAGTAAGG + Intronic
1120565305 14:86048043-86048065 AGGATTCTAGAGAGGTAGTGAGG + Intergenic
1120764504 14:88316230-88316252 AGGGTTGAAGGGAGGGAGTAAGG - Intronic
1121463540 14:94100048-94100070 AGGGTTTGACTGAGGGAATATGG + Intronic
1121989599 14:98543113-98543135 AGTTTTTTGGGGAGGGAGTAAGG - Intergenic
1121993874 14:98586539-98586561 AGGGTTTTAGAAAGGTAATATGG + Intergenic
1122478593 14:102030027-102030049 AGGGTTAGAGAGAGGGAGGGAGG + Intronic
1124206117 15:27722550-27722572 AAGGTGATAGAGAGGGAGTGGGG - Intergenic
1126018031 15:44372299-44372321 ATGGCTATAGAGAAGGAGTATGG - Intronic
1126699271 15:51353252-51353274 AGGGTTTTAGAAAGATAGTTTGG - Intronic
1127815846 15:62608245-62608267 AGGGTTTAAGACAGAGAGTTAGG + Intronic
1127943371 15:63724449-63724471 AGGGTTGGAGAGTGGGAGTGAGG - Intronic
1127947721 15:63771789-63771811 ATGGCTTTAGAGAGGAAGGAGGG + Intronic
1129946623 15:79543946-79543968 TTGGTTTTAGTGAGGGAGGATGG - Intergenic
1130241665 15:82199113-82199135 AGGATGTGAGAGAGGGAGGAAGG - Intronic
1130720303 15:86380207-86380229 AGGGAATGAGAGAGGGAGGAAGG - Intronic
1130924654 15:88375871-88375893 AGGATTGTAGAAAGGGAGGAAGG - Intergenic
1132096440 15:98988424-98988446 AGGGATCTAGAGAGGCAGTCTGG - Intronic
1133895104 16:9919669-9919691 AGAGTTTTAGCGGGGAAGTAAGG - Intronic
1135601748 16:23789647-23789669 AGGGTTTAAGAAGGTGAGTAGGG + Intergenic
1136597596 16:31262274-31262296 AGGGAATGAGAGAGGGAGGAAGG - Intronic
1138507091 16:57483867-57483889 AGGGTTCCAGTGAGGGAGGAGGG + Intronic
1139786670 16:69398498-69398520 ATGGTTTTAGGGAGAGAGCAGGG + Intronic
1141253695 16:82381836-82381858 TGGGTTTTAGAGGGGGTGTGTGG + Intergenic
1141291408 16:82721423-82721445 AGGCAGTTAAAGAGGGAGTAGGG + Intronic
1142781098 17:2181905-2181927 AGGGAGTGAGAGAGGGAGGAGGG + Intronic
1143830461 17:9646334-9646356 AGGTATTTTGAGAGGGAGTGGGG + Intronic
1145403315 17:22563856-22563878 AGGGGTTTAAAGAAAGAGTAGGG - Intergenic
1148507310 17:48138100-48138122 AGGGTTTTAAAGAGAGTTTAAGG + Intronic
1148958687 17:51374908-51374930 AGGGTTTGGGAGGGGGTGTACGG + Intergenic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1149611245 17:57959094-57959116 GGGGCTTGAGAGAGGGAGTGGGG - Intergenic
1149891948 17:60397871-60397893 AGAGTTTTACAGTGGGAGTGAGG + Intronic
1151050927 17:70978288-70978310 AGGGTTGAAGAGAGGAAGGAAGG + Intergenic
1152012021 17:77724635-77724657 AGGGTGTGAGAGAGGCAGCAAGG + Intergenic
1153303539 18:3612326-3612348 AGGGTTGTAGAGAGGCTGAAAGG + Intronic
1153365217 18:4248143-4248165 AGGCTTTTGGAGAGGCAGCAAGG - Intronic
1153481918 18:5555578-5555600 AGGGTTTGGGAGAGAGAGTAAGG - Intronic
1153505942 18:5798060-5798082 AGGGTTTGAGTGATGGAGCATGG - Intergenic
1155080551 18:22406262-22406284 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1155114249 18:22749064-22749086 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1155224265 18:23714756-23714778 AGGGTTCTAGAGATGGATGACGG - Intronic
1156860987 18:41836105-41836127 AGTGTTTCAGTGAGGGAGTGGGG - Intergenic
1158234894 18:55301850-55301872 AGAGTTTTGGAGGGGGAGAAAGG - Intronic
1159357219 18:67351677-67351699 AGGATATTAGAGAAGGAGTCTGG - Intergenic
1161777071 19:6269434-6269456 AGAGGCTTAGAGAGGGAGGAAGG + Intronic
1163593099 19:18205147-18205169 AGGGTTTGAAAGCTGGAGTAGGG - Intergenic
1164651634 19:29895028-29895050 AGGGGATGAGGGAGGGAGTAGGG + Intergenic
1164651640 19:29895047-29895069 AGGGAATGAGGGAGGGAGTAGGG + Intergenic
1164651646 19:29895066-29895088 AGGGAATGAGGGAGGGAGTAGGG + Intergenic
1164746660 19:30621371-30621393 AGAGTTTTAGAAAGGGGGTGTGG + Intronic
1165424359 19:35737782-35737804 AGGGTCTTAGAGAGTGAGCAGGG + Intronic
1165743430 19:38217032-38217054 AGGGTTTGGGAGAGGCAGTAGGG - Intronic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166676826 19:44746104-44746126 AGGGTTTGAGAGAGGAGGTGAGG - Intergenic
1166676874 19:44746301-44746323 AGGGTTTGAGAGAGGAGGTGAGG - Intergenic
1167400825 19:49267607-49267629 AGGTTTTTGGAGAGGCTGTAGGG + Intergenic
925695310 2:6571054-6571076 AGGGTTTTGGGGCTGGAGTAGGG - Intergenic
926397586 2:12459922-12459944 AGGGTTTTGGGTAGGGAGGAGGG - Intergenic
926616186 2:14999030-14999052 AGGGTCTCTGAGAGGGAGCAGGG - Intergenic
926690909 2:15732733-15732755 AGGGTTCTAGAGATGGGGTGGGG + Intronic
928172403 2:29012091-29012113 AGGCCTTTAAAGAGGGAGGAGGG + Intronic
928750672 2:34466945-34466967 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
930060944 2:47287878-47287900 AGGGTTATGGAGAGGGAAGATGG + Intergenic
931339232 2:61382492-61382514 AGTGTGATACAGAGGGAGTATGG - Intronic
931814857 2:65890386-65890408 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
933891703 2:86778080-86778102 AAGGTATGAGGGAGGGAGTAGGG + Intergenic
935028041 2:99296270-99296292 GGGGTTTTACAGAGGGGGAATGG - Intronic
935628890 2:105195660-105195682 AGGATTTTAGAGAAGGAGGCTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938029969 2:127983652-127983674 AGGGTCTTTGGGAGGAAGTACGG + Intronic
938977745 2:136495531-136495553 AGGGAATTAGAGAGGGAGGAGGG - Intergenic
939640824 2:144638378-144638400 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
939687124 2:145213531-145213553 AGGGATCTAGAGAGGCAGTCTGG + Intergenic
939942022 2:148362419-148362441 AGGGATCTAGAGAGGCAGTCTGG - Intronic
940782897 2:157952306-157952328 AGGTTTTTAGAGTGGTAGTTAGG + Intronic
943105731 2:183543982-183544004 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
943512332 2:188841053-188841075 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
943747042 2:191472711-191472733 AGGGTTTGAGAGAGAAAGGAAGG - Intergenic
943836844 2:192524907-192524929 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
944301661 2:198130929-198130951 AGGGCTTTAGGAAGGGAGAATGG - Intronic
945148481 2:206763556-206763578 AGGTTTTTAGAAGGGGAGGAGGG - Intronic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946311061 2:218882933-218882955 AGGGTTTTCCAGAGGCAGCAGGG - Intronic
1169397024 20:5241426-5241448 AGGAATCTAGAGAGGTAGTATGG + Intergenic
1169736890 20:8847367-8847389 TGGGTGTTTGAAAGGGAGTAAGG - Intronic
1170069805 20:12353953-12353975 TGGGTTTTAGTTAGGGTGTAAGG + Intergenic
1170229368 20:14028120-14028142 AGGAATCTAGAGAGGCAGTATGG + Intronic
1170454622 20:16520462-16520484 AGGAATTTAGAGAGGCAGTCTGG - Intronic
1173751807 20:45482289-45482311 GGGCATTAAGAGAGGGAGTATGG - Intergenic
1174101064 20:48126499-48126521 AGGGTTTTAGAGCTGGAGCCTGG - Intergenic
1175173816 20:57097697-57097719 ATGGGATTAGGGAGGGAGTATGG + Intergenic
1178853500 21:36232393-36232415 AGGGTCTCAGAGGAGGAGTATGG - Intronic
1180910526 22:19447135-19447157 AGTGGTTTAGAGAGGGAAGAGGG - Intronic
1181447540 22:22989399-22989421 TTGGTTATAGAGATGGAGTAGGG - Intergenic
1182963942 22:34504179-34504201 AGGCTGGTAGAGAGGGAGCAGGG + Intergenic
1183013069 22:34963183-34963205 AGTGGTTCAGAGAGGGAGTCTGG + Intergenic
1183237201 22:36628335-36628357 TGGATATTAGAGAGGGAGTAAGG + Intronic
1184352602 22:43954511-43954533 AGGGTTTCTGGGAGGGAGTAAGG + Intronic
1184967961 22:47995377-47995399 AGGGTTGGAGAGAGGGAGGGAGG + Intergenic
950649843 3:14400583-14400605 AGGGTCTGAGAGAGTGAGCAAGG - Intergenic
950836050 3:15920032-15920054 GGGGGTTTTGAGATGGAGTAAGG + Intergenic
951237689 3:20254395-20254417 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
952559525 3:34574620-34574642 TTGGTTTTAGAGAAGAAGTAAGG - Intergenic
952712491 3:36445438-36445460 AGGGGTTTAGAAAGGGGATATGG + Intronic
954576226 3:51677864-51677886 AGGGTTTCAGGGATGGAGAATGG - Intronic
955031480 3:55225676-55225698 AGGGTTTTAGAGATGAGGTAAGG + Intergenic
955118875 3:56035593-56035615 AGGGCTTGACAGAGGGAGTTTGG + Intronic
955402853 3:58605727-58605749 AAGATTATAGAGAGGGGGTAAGG - Intronic
956012924 3:64850730-64850752 AGAGTTGCAGAGAGGGAGGATGG + Intergenic
956355742 3:68390288-68390310 AGGGATCTAGAGAGGCAGTCTGG - Intronic
956756342 3:72391517-72391539 TGGGTTTTACAGAAGAAGTATGG - Intronic
957011208 3:75008275-75008297 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
958696565 3:97535461-97535483 TGGGTTGTAGAGATGGAGAAGGG + Intronic
959260582 3:104074618-104074640 ACAGATGTAGAGAGGGAGTATGG + Intergenic
959531973 3:107443309-107443331 TGGCTTTTGGAGAGGGAGCAGGG - Intergenic
959689970 3:109187999-109188021 AGGGATTTAGAGAGGAAGGAAGG + Intergenic
961897435 3:130180266-130180288 AGGGTATTAGAGTCTGAGTAAGG + Intergenic
962667444 3:137669383-137669405 AGGGTTTAGGAAAGGGAGAAGGG - Intergenic
963417660 3:145018129-145018151 AGTGGTTTAGAGGGGGAGTATGG + Intergenic
963599451 3:147365073-147365095 AGGGGTTTAGAGGGGGAGATGGG + Intergenic
963821611 3:149901548-149901570 AGGGGTTGAGAAAGGGAATAGGG - Intronic
966493748 3:180556725-180556747 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
966673306 3:182554716-182554738 AGGGATCTAGGGAGGGAGGAAGG - Intergenic
966682687 3:182660025-182660047 TGTGATTTAGAGAGGGAGAATGG - Intergenic
969490375 4:7496190-7496212 AGGGTGATAGACAGGGAGTCAGG - Intronic
970670341 4:18389595-18389617 AGTGTTTTAGAGAAGGCTTAAGG - Intergenic
971259828 4:25046006-25046028 AGGGTTTAAGTGATGGAATAAGG - Intergenic
973866553 4:55119984-55120006 AGAGTTTTAAAAAGGGAGCATGG + Intronic
974062657 4:57049623-57049645 AGGATTTTAGAGAAGAAATAAGG - Intronic
975108288 4:70594559-70594581 AGTGTTTTAGAGAAAGAGAATGG + Intronic
975912202 4:79280223-79280245 AAGGCTTTAAAGAGGCAGTAAGG + Intronic
977924760 4:102687359-102687381 AGGATTTTAAGGAGGGGGTAAGG - Intronic
979012343 4:115387681-115387703 AGGGATCTAGAGAGGCAGTCTGG - Intergenic
979418212 4:120469802-120469824 AGGGTTTGACTGAGGGAGTTAGG + Intergenic
980248310 4:130277216-130277238 AGGGTTATAGAGGGAGATTAAGG + Intergenic
981173183 4:141648567-141648589 AGGGTTTAAGAGAAGAAATATGG + Intronic
981452428 4:144913869-144913891 AGGATTATAGAGAGGGAGTTGGG - Intergenic
981865255 4:149409739-149409761 CTGCTTTTAGAGAGGGAGTGTGG - Intergenic
982097453 4:151935785-151935807 AGGGTTTTGTAGATGGAGAAGGG + Intergenic
982183617 4:152774039-152774061 AGGGATTGGGAGAGGGAGGAAGG - Intronic
982428587 4:155296303-155296325 AGGGTTTCAGTGGGGAAGTATGG - Intergenic
982503553 4:156190410-156190432 AGGGTTTTTGAAAAGGGGTATGG + Intergenic
982739514 4:159043112-159043134 AGGGAGTTAGTGAGGGAGAAGGG - Intergenic
983116209 4:163819598-163819620 AGGGATTTGGAGAGGTAGGAGGG - Intronic
983423353 4:167549303-167549325 GGGGTTACAGAGAGGGAGTGAGG + Intergenic
985064457 4:186106544-186106566 AGGATTTTTTGGAGGGAGTAGGG - Intronic
985909671 5:2869066-2869088 GGGGTTGTAGAGGGGGAGTGGGG + Intergenic
986378810 5:7162510-7162532 AGGAATCTAGAGAGGGAGTTTGG + Intergenic
988724139 5:33908973-33908995 TGTGTTTTAGAGTGGGAGTTGGG + Intergenic
988818202 5:34854985-34855007 AGGGTTGTAAAGAAGGAGTAGGG + Intronic
990014279 5:51039878-51039900 AGGTTTTCAGAGAGGCATTATGG - Intergenic
990914006 5:60882907-60882929 AGGCTTCTAGAGACAGAGTAGGG - Intronic
991433048 5:66568282-66568304 AGGGTTTAAGAGCTGGAATAGGG - Intergenic
992032834 5:72740488-72740510 AGGGTTCTAGAGATGGATGATGG - Intergenic
993911576 5:93690487-93690509 AGGAATTTAGAGAGGCAGTCTGG - Intronic
994030471 5:95136158-95136180 AAGGTTGAAGAGAGGGAGAAGGG - Intronic
997702489 5:135912544-135912566 AGGGTGATAGTGAGGGAGAATGG - Intergenic
1000662175 5:163950532-163950554 AGGGCTTGAGATAGGGAGGAGGG - Intergenic
1000704159 5:164490171-164490193 AGGGCTTAACAGAGGGAGTTTGG - Intergenic
1001205589 5:169759819-169759841 AGGGATTCAGAGTGGGAGGAGGG + Intronic
1001277192 5:170359554-170359576 AGGGTTGCAGAGAGTGAGTGGGG - Intronic
1002673554 5:180890131-180890153 AGGACTCTAGAGAGGGAGTCGGG - Intergenic
1004141968 6:13026546-13026568 TGGCTTGTAGAGAGGGAGGAAGG + Intronic
1005443129 6:25893295-25893317 AGGGTTTGAGGGAGTGAGTTTGG - Intergenic
1006298729 6:33181850-33181872 AAGGTTCTAGGGAGGGAGTTTGG - Intronic
1007640454 6:43334990-43335012 ATGGTTTTAGAGAAAGAGTTGGG - Intronic
1008095799 6:47338091-47338113 AGGGTTTGAGACTGGGAGTAGGG + Intergenic
1009625443 6:66134880-66134902 GGAATTTTAGAGAGGGAGAAAGG - Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1013253063 6:108354157-108354179 AGGCTTTCTGAGAGGGAATAAGG + Intronic
1013846491 6:114459222-114459244 AAGGTTTTAGGCATGGAGTATGG - Intergenic
1014726675 6:124979414-124979436 AGGGGTTTAGAAAGGCAGTGTGG + Intronic
1016590905 6:145742367-145742389 AGGGATCTAGAGAGGCAGTCTGG - Intergenic
1017008310 6:150044086-150044108 TGGGTATTTGAGAGGGAGCAAGG - Intergenic
1020716077 7:11675698-11675720 AGGATTCTAGAGAGGCAGTCTGG - Intronic
1021166985 7:17354150-17354172 AGGGATCTAGAGAGGCAGTCTGG + Intergenic
1023058321 7:36307253-36307275 AGGGTTTGGAAGAGGGAGGAGGG - Intergenic
1026474577 7:70723902-70723924 AGGGTTTTTGAGACAGAGTCTGG + Intronic
1027641016 7:80734021-80734043 AGGCTTTTTGAGAGGAAGAATGG - Intergenic
1028239284 7:88399483-88399505 AGGGTTTGGGAGATAGAGTATGG + Intergenic
1029361626 7:100092419-100092441 AGAGCTTTAGAGTGGGAGTTGGG + Intergenic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1031294259 7:119982807-119982829 AGCTGCTTAGAGAGGGAGTAGGG + Intergenic
1031648196 7:124253281-124253303 AGTGTTTTAGGGAGGGAATGGGG - Intergenic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1034351013 7:150414764-150414786 AGGGTTCTAGAGAGGGAGAGTGG - Intergenic
1036017734 8:4804566-4804588 AGGGAATTAGGGAGGGAGGAAGG + Intronic
1038223876 8:25636610-25636632 AGGAGGTGAGAGAGGGAGTATGG - Intergenic
1039424150 8:37471812-37471834 AATGTTTTGGAGAGGGAGTAGGG - Intergenic
1040567125 8:48577392-48577414 AGGGATTTGGAGATGGGGTAAGG + Intergenic
1040923897 8:52655112-52655134 AGGGTTTAATAGAGGAATTAGGG - Intronic
1042359236 8:67863591-67863613 AGGGATTTAGAGAGTGAGGGAGG - Intergenic
1042470823 8:69185935-69185957 AGGGTGTGAGAGAGGGAGGGGGG - Intergenic
1042829610 8:73012148-73012170 AGGCCTGAAGAGAGGGAGTAAGG + Intronic
1043006804 8:74829991-74830013 AAGATTTTAGAGAAGGATTAGGG + Intronic
1045290352 8:100827587-100827609 AGGGTCTTAGAGGGGGGTTAAGG + Intergenic
1045342252 8:101265679-101265701 AGGGAATTAGAGAAGGAATATGG - Intergenic
1047060848 8:121223468-121223490 AGGGCTTGACAGAGGGAGTTTGG - Intergenic
1047133697 8:122051796-122051818 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1047399875 8:124537360-124537382 AAGGTTTTAGAGTGGCAGTTTGG - Intronic
1047710670 8:127548965-127548987 AGGGTTATAGAGATGGGGGAAGG - Intergenic
1049039912 8:140104834-140104856 AGGGTTAGAAAGAGGAAGTAAGG - Intronic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1050406131 9:5310146-5310168 AGGGTTTTAGAGAGGGCTTGGGG + Intergenic
1052193080 9:25680062-25680084 AGGGATGAAGAGAGGGAGAAAGG + Intergenic
1053041500 9:34877465-34877487 AGGGTTTTGGGGAGGGATGAGGG + Intergenic
1053070726 9:35100282-35100304 CAGGTTTGAGAGAGGGAGAAAGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055985303 9:82053028-82053050 ATGGTCTTAGAGAGTGAGGAAGG + Intergenic
1056320942 9:85433850-85433872 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
1057427922 9:94968720-94968742 AGGGTTTTAGAGAGGATTAAAGG + Intronic
1059084472 9:111285209-111285231 GGGGGTTAAGAGAGGGAGCAGGG - Intergenic
1060134130 9:121135267-121135289 ATGGTTTAATAGAGAGAGTATGG + Intronic
1060456339 9:123802321-123802343 AGGGTTTTGGAGAGTAAGGAAGG - Intronic
1061212942 9:129203896-129203918 AGGGGTTTGAGGAGGGAGTATGG + Intergenic
1185644133 X:1605097-1605119 AGGGGTTGAGAGAGGGAGGAGGG - Intergenic
1186499586 X:10040689-10040711 AGGCTTGGAGAGAGGGAGAAAGG - Intronic
1186930493 X:14383948-14383970 AGGGTTTGAGAGAGGTAGGTAGG - Intergenic
1187654835 X:21459946-21459968 AGAGTTTTGGAAAGGGAGAAGGG - Intronic
1189011184 X:37047188-37047210 AGAGTTTTGGAGAAGGAGTAGGG - Intergenic
1190358884 X:49630851-49630873 GGGGTTTTAGAGCCGTAGTAGGG - Intergenic
1191785020 X:64908017-64908039 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
1191822097 X:65321890-65321912 AGGGGTGTAGGGAGGGAGGAAGG + Intergenic
1191947775 X:66554226-66554248 AGGATTCTAGAGAGGCAGTCTGG - Intergenic
1192555487 X:72085815-72085837 CGGGTGGTAGGGAGGGAGTAGGG - Intergenic
1192573803 X:72227005-72227027 AGGGATTTAGTGTTGGAGTAGGG - Intronic
1192797963 X:74440159-74440181 AGGGTTTTAGAGAGGGAGTAGGG + Intronic
1192999600 X:76550151-76550173 AGGGATCTAGAGAGGCAGTCTGG + Intergenic
1193361680 X:80586581-80586603 AGGGATCTAGAGAGGCAGTCTGG + Intergenic
1194361127 X:92951722-92951744 AGGGTTTGAGAAAGGGAACAGGG + Intergenic
1195381829 X:104278353-104278375 AGAGTTTTTCAGAGGGAGTGTGG - Intergenic
1195937621 X:110140532-110140554 AGGGTTGTAGAGTGGGAGGAAGG + Intronic
1196862924 X:120044336-120044358 ATAGTTTTAGGGAGGGAGTTAGG - Intergenic
1196880178 X:120192008-120192030 ATAGTTTTAGGGAGGGAGTTAGG + Intergenic
1197191114 X:123648748-123648770 AGGAATTTAGAGAGGCAGTCAGG - Intronic
1198597958 X:138257626-138257648 AGAGATTCAGAGAGGCAGTAAGG + Intergenic
1199315841 X:146376749-146376771 AGAGTTTTTGAGAGGGTGAAAGG - Intergenic
1200669321 Y:6067531-6067553 AGGGTTTGAGAAAGGGAATGGGG + Intergenic
1201230997 Y:11864113-11864135 AGGAATTTAGAGAGGCAGTCTGG + Intergenic