ID: 1192801933

View in Genome Browser
Species Human (GRCh38)
Location X:74473983-74474005
Sequence CGCTTCCTCAGCAGTGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192801933 Original CRISPR CGCTTCCTCAGCAGTGTCCA TGG Intronic