ID: 1192804767

View in Genome Browser
Species Human (GRCh38)
Location X:74498926-74498948
Sequence CTGTGCCTATGGAATACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192804754_1192804767 22 Left 1192804754 X:74498881-74498903 CCACCTGGGGGTTTTTGCTTTTG 0: 1
1: 1
2: 3
3: 27
4: 386
Right 1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 142
1192804763_1192804767 -10 Left 1192804763 X:74498913-74498935 CCAGGTAAGGGGCCTGTGCCTAT 0: 1
1: 0
2: 1
3: 7
4: 140
Right 1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 142
1192804762_1192804767 -9 Left 1192804762 X:74498912-74498934 CCCAGGTAAGGGGCCTGTGCCTA 0: 1
1: 0
2: 2
3: 8
4: 109
Right 1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 142
1192804756_1192804767 19 Left 1192804756 X:74498884-74498906 CCTGGGGGTTTTTGCTTTTGGCT 0: 1
1: 1
2: 1
3: 20
4: 236
Right 1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192804767 Original CRISPR CTGTGCCTATGGAATACAGT GGG Intronic
904457055 1:30654091-30654113 CTGGGGCTTTGGAATTCAGTTGG - Intergenic
906730738 1:48078776-48078798 CTGTGCCTATGGAAATCATATGG - Intergenic
907665467 1:56430562-56430584 CTGTTCCTATTGGATACAGCAGG + Intergenic
908925274 1:69246938-69246960 CTGTTCCCATTGAATACACTGGG - Intergenic
911941254 1:104050847-104050869 CAGTCCCTATGAAAAACAGTTGG + Intergenic
917139508 1:171821103-171821125 CTGTTACTGTGGAAAACAGTTGG - Intergenic
918336559 1:183520952-183520974 CACTGCCTGTGGAATGCAGTCGG - Intronic
920917928 1:210272986-210273008 CTGTGCTAATGGAATTCAGAAGG - Intergenic
921768368 1:219001394-219001416 CTGTGGTAATGGATTACAGTTGG - Intergenic
923441707 1:234027049-234027071 CTGGGCTTATGGAATACAACTGG - Intronic
1062892183 10:1071819-1071841 CTGTGCCTGGGGAATTCCGTTGG + Intronic
1063294672 10:4792658-4792680 CTGCCCTTATGGAATCCAGTAGG - Intronic
1069733616 10:70636231-70636253 CAGTGCCTGTTGAATACAGCTGG - Intergenic
1070439414 10:76428627-76428649 CTCTCCCTATGAGATACAGTGGG + Intronic
1070722207 10:78764611-78764633 CTGTGCCTATGCAAAGGAGTGGG + Intergenic
1071529588 10:86378549-86378571 CAGCCGCTATGGAATACAGTAGG + Intergenic
1072776353 10:98199076-98199098 CTGTGCATATAAAATACATTTGG - Intronic
1076005347 10:126944322-126944344 CTGTGCCCGTGGTAGACAGTAGG + Intronic
1076098870 10:127757641-127757663 CTGCACCTATGGGATACAGAGGG - Intergenic
1078950075 11:16120867-16120889 CTGTAACTATGGAAGAGAGTTGG - Intronic
1082955727 11:58867936-58867958 CCGTGCTTATGGGATGCAGTGGG - Intronic
1085057528 11:73414991-73415013 CTGTCCTTGTGGCATACAGTGGG - Intronic
1085997816 11:81942789-81942811 CTCTGCCAATGGAATAGAGAAGG + Intergenic
1093483574 12:19629158-19629180 CTTTGCCTCTGGAATATAGAAGG - Intronic
1104047225 12:125171955-125171977 CTCTGCCTACGGAAGAAAGTAGG + Intergenic
1104872735 12:132011951-132011973 CTGTGCCTGTGGAAGCCAGCAGG - Intronic
1105997141 13:25683312-25683334 CTGTCCCTGTGGACTGCAGTTGG + Intronic
1108390403 13:49941877-49941899 CTGTGTCTTTGAAGTACAGTAGG + Intergenic
1111904812 13:94242633-94242655 CTGTGTTTAGGGATTACAGTGGG + Intronic
1111995477 13:95161916-95161938 TTGTGTCTATGTAAAACAGTGGG - Intronic
1114527943 14:23378057-23378079 CTGTACCTATGAATTACTGTGGG + Intronic
1114668567 14:24396838-24396860 CTGCCCCCATGGAATACAGGAGG - Intergenic
1116493756 14:45536547-45536569 CTGTGTCTGTAGAATACAGGTGG + Intergenic
1121207030 14:92178299-92178321 CTCTGCCTTTGAAATAAAGTAGG + Intergenic
1121275180 14:92662487-92662509 CTGTGCCTATTGAACACAAGAGG - Intronic
1121676777 14:95759979-95760001 CAGCCCCTATGGAATACAATGGG - Intergenic
1125791299 15:42368004-42368026 CCATGCCTATGGCATAAAGTTGG - Intronic
1126916939 15:53476445-53476467 CTGTGCTTTTGCAATAGAGTTGG + Intergenic
1127836048 15:62792078-62792100 CTGTCCCCATGGGATACAGCTGG + Intronic
1130812841 15:87399592-87399614 TTTTGCCCATGGAATGCAGTTGG - Intergenic
1134878915 16:17727323-17727345 CTTTGTCTTTGGTATACAGTAGG - Intergenic
1136997245 16:35198874-35198896 CTGTGCCTATAGCCTACACTGGG - Intergenic
1141133677 16:81451912-81451934 CGGTGCCTGTTGAATACACTGGG - Intronic
1141243026 16:82280485-82280507 CTGTGCCAAAGGAATAGATTTGG - Intergenic
1141312021 16:82923533-82923555 CTGAGGCTATGGAATCTAGTGGG + Intronic
1143265255 17:5632118-5632140 TTGGGCCTATAGAAGACAGTGGG - Intergenic
1145223540 17:21108510-21108532 CAATGCCAATGGAATACAGAAGG - Intergenic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1153057481 18:960907-960929 CTTTGACAAGGGAATACAGTTGG + Intergenic
1153716887 18:7859341-7859363 CTGTGTCTAAAGAATGCAGTGGG - Intronic
1155855008 18:30822184-30822206 CTCTGGCTTTGGAATAAAGTTGG - Intergenic
1158698161 18:59721171-59721193 CTGTGCTTATGGAATACCCCTGG - Intergenic
1160373726 18:78395342-78395364 CTTTGCCAGTGGAATCCAGTTGG - Intergenic
1160423261 18:78763531-78763553 CTGTGCCTTTGACATACACTGGG - Intergenic
1160725335 19:615645-615667 ATGTGCTTATTGTATACAGTAGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164966907 19:32493058-32493080 CTCTTCCTCTGGCATACAGTAGG - Intergenic
927383494 2:22506398-22506420 ATGTGCTCATGGAATACACTAGG + Intergenic
927817638 2:26233253-26233275 ATGTGACTATTGAATACTGTAGG + Intronic
927895060 2:26776243-26776265 CTGTGCCTATGAACTATAGGGGG + Intronic
933936078 2:87204901-87204923 CTGGACATCTGGAATACAGTAGG - Intergenic
935881760 2:107572592-107572614 CTGTGCCTGTGGCCAACAGTGGG - Intergenic
936234990 2:110734783-110734805 CTGTCCCTATGGAATTCACAAGG - Intronic
936357070 2:111760928-111760950 CTGGACATCTGGAATACAGTAGG + Intergenic
942069455 2:172303244-172303266 CTGTGCCTGTGGAGTACATCTGG + Intergenic
942655845 2:178213293-178213315 ATGTGCCTCTGGAATTCAGAAGG - Intronic
944318174 2:198305831-198305853 CTTTGCCTATAGAATCAAGTTGG - Intronic
946218282 2:218203349-218203371 CTGAACCTATGTAATACAATAGG - Intergenic
946251014 2:218412365-218412387 CTGTGCCTTTCCAATACAGAAGG + Intergenic
948538462 2:238666496-238666518 CTGTGCCTCTGGCATCCAGTGGG + Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1173140291 20:40475993-40476015 ATATGCCTATGGAATACTGATGG + Intergenic
1174886840 20:54345033-54345055 CTGTGCCTGTGGCTTCCAGTGGG + Intergenic
1176232583 20:64039668-64039690 CTGTGCCTCTGGCATTCTGTGGG + Intronic
1176589193 21:8625488-8625510 CTATGCATATTGAATTCAGTAGG - Intergenic
1179422918 21:41250302-41250324 CTGGGCTTATGGAATTCAGAGGG + Intronic
1180272021 22:10602485-10602507 CTATGCATATTGAATTCAGTAGG - Intergenic
1182391787 22:30003636-30003658 CTGTTCCTAATGAATACAATGGG + Intronic
949138119 3:596273-596295 CTATGCATATTGAATTCAGTAGG + Intergenic
950077345 3:10196436-10196458 CTGGGCCTGTGGAAGGCAGTGGG + Intronic
950278696 3:11686097-11686119 CAGTCTCTATGGAAAACAGTAGG + Intronic
952100636 3:30008721-30008743 CTGTGGCATTGGAAGACAGTTGG + Intronic
955340241 3:58119829-58119851 ATGTGCCTGTGGAACACATTTGG + Intronic
956128247 3:66031463-66031485 CTGTGGCAATGGCATACAGTTGG - Intronic
957021858 3:75136834-75136856 CTGTACATCTGGAATACGGTAGG + Intergenic
958648957 3:96911503-96911525 GCATGCCCATGGAATACAGTAGG + Intronic
959774341 3:110138841-110138863 CTGTGCCTGTGGAACACATTTGG + Intergenic
960799163 3:121520620-121520642 CTGTTCCTGTGGAAAACAGCAGG + Intronic
962769386 3:138598469-138598491 CTGTGGGTCAGGAATACAGTAGG + Intergenic
964653891 3:159044612-159044634 CTATGCCAATGCAATACACTAGG + Intronic
964804143 3:160588092-160588114 CTCTGCCTATGGAAAGCAGAGGG + Intergenic
964961106 3:162427742-162427764 CTGTGCCTATGGAAAGGAGATGG + Intergenic
973019387 4:45182808-45182830 CTGTAATTATGGAAGACAGTGGG + Intergenic
973137281 4:46724230-46724252 CTGGGCTTATGGGATACAGCTGG - Intergenic
975780502 4:77834334-77834356 ATATGCATATGGAATTCAGTGGG + Intergenic
978576234 4:110192996-110193018 CTGTGACTATGGAACAGAGTAGG - Intronic
979687730 4:123528936-123528958 CTATGCAAATGGTATACAGTGGG + Intergenic
983456033 4:167966225-167966247 CTGTCCCTACAGAAAACAGTAGG - Intergenic
988008523 5:25451605-25451627 CTGTGTCTATGGAAAACTGTAGG - Intergenic
988439027 5:31210888-31210910 CTTTGCTTATACAATACAGTTGG - Intronic
991426863 5:66500747-66500769 GTGTGTTTATGGAATACGGTGGG - Intergenic
992216390 5:74528633-74528655 CAATGCCTAGGGAATAAAGTTGG + Intergenic
996283741 5:121764163-121764185 CTGTGCTTCTGGAACATAGTGGG - Intergenic
996778718 5:127160396-127160418 CTCTGTTTATGGAATACAGGCGG + Intergenic
999106868 5:149079597-149079619 ATGTGCCTTTGGAATAAATTTGG - Intergenic
999199935 5:149808789-149808811 CTGGGCATTTGGGATACAGTGGG + Intronic
999498028 5:152119399-152119421 CTGCACCTCTGGAATGCAGTGGG - Intergenic
1003413289 6:5885213-5885235 CTCTGCTTCTGGAATACAGCTGG + Intergenic
1004790310 6:19018755-19018777 CTGTTGCTATGGAATACTGTTGG + Intergenic
1006699539 6:35960795-35960817 CTCTGCCTAAGGGATAGAGTGGG - Intronic
1011028071 6:82891275-82891297 CTGTGCTAATGGAATCTAGTGGG + Intergenic
1011030091 6:82913047-82913069 CAGTGGCTATGCAATCCAGTGGG + Intronic
1012368645 6:98475484-98475506 CTATATCTATGTAATACAGTTGG - Intergenic
1012869389 6:104656259-104656281 CTCTGTCTATAGAATACAGGTGG - Intergenic
1014761212 6:125358997-125359019 CAGTGACTTTGGAAAACAGTTGG - Intergenic
1018590844 6:165420122-165420144 CTGAGCATTTGGAATACTGTGGG - Intronic
1020144590 7:5632825-5632847 GTGTACCTATGGATCACAGTGGG + Intronic
1020240648 7:6391973-6391995 CTGGGCTTATGGGATACAGCTGG + Exonic
1025776000 7:64561468-64561490 CTGTGCCTATGGAAGATAAAAGG + Intronic
1030319408 7:108148112-108148134 CTTTGCCTATGGGGCACAGTAGG - Exonic
1031130694 7:117830020-117830042 CTGTTTCTATGGAATGGAGTAGG - Intronic
1031478933 7:122255278-122255300 CTGTGGCTGTTGAATACAGAAGG - Intergenic
1034891572 7:154844107-154844129 CTGTGCCAAGGCAATACAGATGG + Intronic
1035902102 8:3467862-3467884 CTATTCCTATGGTATACACTTGG + Intronic
1036514735 8:9433450-9433472 CTGTGCCTCTGTAATCCTGTTGG - Intergenic
1037484408 8:19333920-19333942 CTGAGCATTTGGAATACACTTGG + Intronic
1037745915 8:21643966-21643988 CTGTGGCCAGGGAATAAAGTGGG + Intergenic
1038079218 8:24114156-24114178 CTTTGAGTATGGAATAAAGTGGG + Intergenic
1039892285 8:41693835-41693857 CAGTGCGTCTGGAACACAGTAGG - Intronic
1040792661 8:51250971-51250993 CTGTGCTTAGGAAGTACAGTTGG - Intergenic
1047399147 8:124531503-124531525 CTGTCGCTGTGGAATTCAGTGGG + Intronic
1049588154 8:143441335-143441357 CTGTGCCCAGGGCCTACAGTTGG - Intronic
1050653049 9:7793666-7793688 CTGTGACTGGGAAATACAGTTGG + Intergenic
1051066880 9:13115319-13115341 CTGTGCCTAGGGAACACTGGGGG + Intronic
1051892089 9:21952843-21952865 CTGTGGTAATGGATTACAGTTGG + Intronic
1055234850 9:74108408-74108430 CTTTTACTATGGAATAGAGTTGG - Intergenic
1055850259 9:80619351-80619373 CTGCTCCTATGTAATAAAGTAGG - Intergenic
1055972687 9:81927651-81927673 ATGTGCCCATGGAATACATGAGG + Intergenic
1055974440 9:81942723-81942745 ATGTGCCCATGGAATACATGAGG + Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1057860915 9:98640231-98640253 CTGTACCTATAGCACACAGTAGG + Intronic
1187479784 X:19644618-19644640 CTATGCCTATGAAATACATATGG + Intronic
1187878987 X:23828851-23828873 CTGTGACTCTGGAAGACAGAAGG - Intergenic
1190181305 X:48195090-48195112 CTGTGACCGTGGAATACATTTGG - Exonic
1192783801 X:74319021-74319043 CAGTGCCCATGGAAAACAGTGGG - Intergenic
1192804767 X:74498926-74498948 CTGTGCCTATGGAATACAGTGGG + Intronic
1193765499 X:85524079-85524101 CTGTGCCCATAGAATAAATTTGG + Intergenic
1193776614 X:85650153-85650175 CTGGGCCTATGGAATGCAGTAGG + Intergenic
1195058551 X:101171346-101171368 CTGTGACAATAGAATCCAGTTGG + Intergenic
1197068632 X:122266612-122266634 CTGTGCCTTTGGAAAAAAGAAGG - Intergenic
1198184413 X:134239343-134239365 TGGTGCCTCTGAAATACAGTGGG + Intronic
1198519843 X:137441658-137441680 CTGGGCTTATGGAATACAGCTGG - Intergenic