ID: 1192804936

View in Genome Browser
Species Human (GRCh38)
Location X:74500210-74500232
Sequence TTGGATGAAGGAGGAAACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192804928_1192804936 -7 Left 1192804928 X:74500194-74500216 CCACCCCCATCAGACTTTGGATG 0: 1
1: 0
2: 2
3: 24
4: 170
Right 1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG 0: 1
1: 1
2: 4
3: 33
4: 326
1192804926_1192804936 -5 Left 1192804926 X:74500192-74500214 CCCCACCCCCATCAGACTTTGGA 0: 1
1: 0
2: 6
3: 31
4: 370
Right 1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG 0: 1
1: 1
2: 4
3: 33
4: 326
1192804927_1192804936 -6 Left 1192804927 X:74500193-74500215 CCCACCCCCATCAGACTTTGGAT 0: 1
1: 0
2: 4
3: 21
4: 186
Right 1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG 0: 1
1: 1
2: 4
3: 33
4: 326
1192804929_1192804936 -10 Left 1192804929 X:74500197-74500219 CCCCCATCAGACTTTGGATGAAG 0: 1
1: 0
2: 2
3: 10
4: 116
Right 1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG 0: 1
1: 1
2: 4
3: 33
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192804936 Original CRISPR TTGGATGAAGGAGGAAACAC GGG Intronic
900337831 1:2173500-2173522 ATGGCTGTAGAAGGAAACACAGG + Intronic
900757790 1:4449225-4449247 TTATATGAAGGAGGAAACTGAGG - Intergenic
900835368 1:4999223-4999245 TTGGAACAGGGAGGAAAGACGGG - Intergenic
900869274 1:5290197-5290219 TTGGAAGAAGAAGCAAATACAGG + Intergenic
903021690 1:20399639-20399661 TTGGATGAATGAAGAAACAAAGG + Intergenic
904299041 1:29542357-29542379 GGGGATGAAGGAGGAAACCGAGG - Intergenic
905166675 1:36087185-36087207 TGGTCTGAAGGAGAAAACACAGG - Exonic
905311986 1:37055652-37055674 TTGTATGGATGAGGAAACAGAGG + Intergenic
905809103 1:40899062-40899084 TTGGATAAAGGAGGAAACTGAGG - Intergenic
906333644 1:44909125-44909147 TTGGATGAAGAAGGAAATGAGGG + Intronic
906851219 1:49251991-49252013 TTGGAGGAAAGAAGACACACTGG - Intronic
906931611 1:50175729-50175751 TTGGTTGTAGGAGGAAACCTGGG - Intronic
907332285 1:53679091-53679113 TTAGATGAAGCGGGAAACACGGG + Intronic
907775929 1:57514829-57514851 TTTGATAAATGAGGAAACAGAGG - Intronic
908485806 1:64591774-64591796 TTGGAAGAGGGAGGAATCATAGG + Intronic
910144332 1:84061557-84061579 TTGGAAGAATGAGATAACACAGG + Intergenic
910898856 1:92097537-92097559 CTGGCTGAAGGAGGAAATAGGGG - Intronic
913148544 1:116016849-116016871 TTGGATGAAGGTGGAAACAGTGG - Intronic
913327726 1:117641620-117641642 ATGGAGGAAGGAAGACACACTGG + Intergenic
916763620 1:167839284-167839306 TGGGATGTAAGAGGAAATACTGG + Intronic
916875465 1:168964001-168964023 ATGGAGGAAGGAGGAGAAACAGG - Intergenic
917236773 1:172901240-172901262 TTGGATGATGGAGGAAATGGGGG - Intergenic
918448002 1:184633642-184633664 TTGTATGAAGGAGGGATCCCTGG + Intergenic
918586795 1:186197453-186197475 TTTGATGACAGAGGAAACACTGG + Intergenic
919871609 1:201826169-201826191 TTGGAGGAAGGACTAAACCCCGG + Exonic
920081279 1:203374603-203374625 TTGGAGGCAGGAGGAAACAGAGG + Intergenic
920110179 1:203582178-203582200 GTGCATGAAGGAGGAAACAGAGG + Intergenic
920403705 1:205693517-205693539 TTGAAAGTAGGAGGAAACACCGG - Intergenic
920646821 1:207809878-207809900 TTGTATGAAGGAGGAAATAATGG - Intergenic
920819603 1:209368025-209368047 AGGGATGAAGGAGGAATGACAGG + Intergenic
921167466 1:212517253-212517275 TTGGATGGAGGCGGCTACACTGG + Intergenic
921494027 1:215814394-215814416 TGGGATTAAAGAGGCAACACAGG + Intronic
921596299 1:217056857-217056879 TGGGAAGAAGAAGGAAACATTGG + Intronic
922020377 1:221698459-221698481 TTGGAATTAGGAGGAAAAACTGG - Intergenic
922907183 1:229183045-229183067 TTGGAAGAAAGCTGAAACACAGG + Intergenic
923620043 1:235571371-235571393 TTATATGAAGGAGGAAACTGAGG - Intronic
924841385 1:247713068-247713090 TGGGATGAAGGCAGAAAGACTGG - Intergenic
1063217137 10:3934827-3934849 TTCTCTGAAGGAGGAAACACTGG + Intergenic
1063332351 10:5173435-5173457 TTGGAGGCAGGAGGAACCAAAGG + Intergenic
1063371756 10:5526835-5526857 TTTTACAAAGGAGGAAACACTGG - Intergenic
1064678782 10:17787918-17787940 TGGAATAAAGGAGGAAATACGGG + Intronic
1065513864 10:26505971-26505993 GTGAATGAAGGAGTGAACACTGG - Intronic
1065708778 10:28495399-28495421 AGGGAGGAAGGAGGAAAGACAGG + Intergenic
1066225216 10:33376039-33376061 TTGGATGAAGCATGAAGAACTGG - Intergenic
1066555476 10:36608144-36608166 AGGGATGAATGGGGAAACACAGG - Intergenic
1067270046 10:44783793-44783815 TTGGATCAAGGAGAGAATACAGG - Intergenic
1067412845 10:46079782-46079804 CTGGGTGAAGCAGGATACACAGG - Intergenic
1067655738 10:48189957-48189979 CTGGATGAATGAGGAAACTGAGG + Intronic
1068679551 10:59804798-59804820 TTGTGTGATGGAGGAAAAACTGG - Intronic
1069181387 10:65364076-65364098 ATGTTTGAAGAAGGAAACACTGG - Intergenic
1069555265 10:69393619-69393641 TTTAATGAAGGAGGAAAAAGAGG + Intronic
1069749689 10:70737265-70737287 ATGCATGAGGGAGCAAACACAGG - Intronic
1070002234 10:72387615-72387637 TTGGATGAATGATGAAACTTAGG + Intronic
1071416227 10:85444449-85444471 TTGGGAAAAAGAGGAAACACCGG + Intergenic
1071992264 10:91111159-91111181 TTGGAGCAAGGAGGAAACTGGGG + Intergenic
1074945381 10:118276206-118276228 CAGGAAGAAGCAGGAAACACTGG - Intergenic
1076043950 10:127275597-127275619 ATGGGTGAAGGTGGAAACGCTGG + Intronic
1076298022 10:129402705-129402727 TGGGAAGAAGGAGGAAACGGTGG + Intergenic
1077981183 11:7302353-7302375 TTAGAAGGAGAAGGAAACACAGG - Intronic
1079360896 11:19769589-19769611 CTGGGTGAAGGAGGAAGCCCTGG + Intronic
1081656156 11:44858792-44858814 TTGGCTGAAGCAGGAACCATGGG + Intronic
1085839591 11:79996366-79996388 GTGGATGAAGGAGTAATAACTGG + Intergenic
1086398583 11:86442384-86442406 TTTGAAGAAGGAGGAAACTGAGG + Intronic
1086599585 11:88616485-88616507 GTGGAAAAAGGGGGAAACACAGG + Intronic
1088183899 11:107142403-107142425 TTGAATGAAGGAGGAAAAGAGGG - Intergenic
1088654384 11:111985457-111985479 ATGAATGAAGAAGGAAACAATGG - Intronic
1088658073 11:112020209-112020231 ATGGATGAATGAGAAAACCCAGG - Intronic
1089394840 11:118129864-118129886 CTGGATGAATGAGGAAACGTGGG + Intergenic
1090602824 11:128390404-128390426 TTGGTAGAAGGAGGAAAATCAGG - Intergenic
1090837009 11:130461283-130461305 CTGGCTGAGGGAGGAAACCCAGG - Intronic
1090855440 11:130606618-130606640 TGGGAAGAAGGAGGAAGAACAGG - Intergenic
1091672816 12:2465390-2465412 TTTTATGAAGGAGGACATACCGG + Intronic
1091877296 12:3946347-3946369 TTGATTGAAATAGGAAACACTGG - Intergenic
1092130870 12:6112266-6112288 CAGCATGAAAGAGGAAACACAGG + Intronic
1093507362 12:19884027-19884049 ATAGATGTAGGAAGAAACACAGG - Intergenic
1095408981 12:41901491-41901513 CTGGATGACAGAGCAAACACTGG + Intergenic
1095528437 12:43156012-43156034 TTGGATGAAGGTGGTAGCAGTGG - Intergenic
1096916736 12:55041127-55041149 TTGGATAAAGGTGGAAAAAAAGG - Intergenic
1098825153 12:75287462-75287484 TAGACTGAAGGAGGAAACCCAGG - Intronic
1098987116 12:77024477-77024499 TTGGATGGAGGAAGAAACTGAGG - Intronic
1099704789 12:86138177-86138199 TTGGATGAAGAAGGAAAAGCTGG - Intronic
1101547704 12:105732162-105732184 TTGGATGAGGGTGGAAAGAAGGG - Intergenic
1102010505 12:109615723-109615745 CTGGATGTAGCAGGGAACACCGG - Intergenic
1105898467 13:24738278-24738300 TTGGATGAAGCAAGAACCACAGG - Intergenic
1106553182 13:30788816-30788838 ATGGAGGAAGGAGGAAGAACAGG - Intergenic
1106716050 13:32389364-32389386 TAGGATGGAGGAAGAAACAATGG - Intronic
1108634018 13:52314686-52314708 TTGGATGGAGGTGGGAACATGGG - Intergenic
1112321697 13:98413737-98413759 TTGTATGAATGATGAGACACAGG - Intronic
1113372431 13:109735411-109735433 TTGAATGAATGAGGAAATTCTGG + Intergenic
1115149205 14:30264619-30264641 TTGAATGAATGAGTAAAGACTGG + Intergenic
1115328097 14:32165034-32165056 GTGGCTGCAAGAGGAAACACAGG - Intergenic
1115922894 14:38396152-38396174 TTGGATGAATGAGGACAAAGAGG + Intergenic
1116210261 14:41930064-41930086 TTTGATAAATGAGGAAACAGAGG - Intergenic
1116580615 14:46636811-46636833 TTGGAGGTAAGAGGACACACTGG + Intergenic
1117348590 14:54858744-54858766 TTGAGTGATGGAGGAAATACTGG - Intronic
1117453068 14:55870949-55870971 TTTTATGAAGGAGGACACAAAGG + Intergenic
1117881570 14:60317897-60317919 TTGAATGAGGGAGGAAAGAAGGG + Intergenic
1118012713 14:61626363-61626385 TTGGATGAAGGAGGCAAAACTGG - Intronic
1118229758 14:63936980-63937002 CTTGATGAAGGAGGAAAATCAGG + Intronic
1119129571 14:72158937-72158959 TCAGATGAAGGAAGAATCACAGG - Intronic
1119531885 14:75367553-75367575 TTGAATGAAGAAGGAAAAAAAGG + Intergenic
1120205916 14:81587559-81587581 TTGGAAGAAGGAGGAAGCAATGG + Intergenic
1120735250 14:88045415-88045437 TTGGAGGAAGGAGGTCACAAAGG - Intergenic
1121619695 14:95337552-95337574 TTTTACGAAGGAGGAAACTCAGG + Intergenic
1122010862 14:98745702-98745724 TTGTATCAAGGAGGAAGAACTGG - Intergenic
1125600822 15:40915037-40915059 TTGAATGAAGGAGGAAGCCCTGG - Intergenic
1125797648 15:42415446-42415468 TTGGATCAAGTAAGAACCACTGG + Exonic
1126428449 15:48555164-48555186 TTGGATCAAGAAGAAAACACAGG - Intronic
1127058916 15:55162051-55162073 TTGGATGAGTGATGGAACACTGG + Intergenic
1127107856 15:55636375-55636397 TTGCAAGGAGAAGGAAACACTGG - Intronic
1127692492 15:61411739-61411761 ATGATTGAAGGAGAAAACACTGG + Intergenic
1128172656 15:65526540-65526562 TTTGATGAATGTGGAAACTCAGG + Intergenic
1128510912 15:68313561-68313583 TTAGAGGAAGGAGGAGACACAGG - Intronic
1129677075 15:77637425-77637447 TTGGAAGGAGGGGGACACACAGG - Intronic
1130100568 15:80890636-80890658 TTGGCTGAAGGAGGATAAAATGG - Intronic
1130841641 15:87706357-87706379 GTAGATGATGGATGAAACACTGG + Intergenic
1131647866 15:94364935-94364957 CTGGAAGAAGGAGGAAAGACGGG - Intronic
1131880173 15:96853959-96853981 TTGGATGCAGGATGCAAAACTGG - Intergenic
1134054790 16:11163149-11163171 TGGGATGAAGCAGGAACCAGAGG + Intronic
1135505763 16:23034750-23034772 CTAGATCAAGGAGTAAACACAGG - Intergenic
1137407114 16:48197888-48197910 TGGGGTCAAGGAGGAAACACTGG + Intronic
1137672236 16:50285704-50285726 TTGCATGAAGGGGGCAACCCTGG - Intronic
1139277743 16:65743583-65743605 TTGCCTGCAGGAGAAAACACTGG + Intergenic
1139797889 16:69497827-69497849 TGGGAAGGAGGAGGAAAAACAGG + Intergenic
1140122667 16:72096957-72096979 TTGGAAGAAGGAGAAATCGCGGG + Exonic
1141847737 16:86622293-86622315 ATGGTTGAAGGAGGAAGAACTGG - Intergenic
1143070002 17:4283759-4283781 TTGGAGGAGAGAGGAAACAAAGG + Intronic
1143828567 17:9632539-9632561 TTGGATGAAGGAGGTACCAGTGG + Intronic
1144226829 17:13157279-13157301 GTGGAGCAAGGATGAAACACAGG + Intergenic
1147134044 17:38425181-38425203 AGGGATGAGGAAGGAAACACAGG - Intergenic
1147254216 17:39172523-39172545 TTTGTTCAAGGAAGAAACACAGG + Intergenic
1147521433 17:41177220-41177242 CTGGATAAAGGAGCAAACTCTGG - Intergenic
1150781660 17:68127940-68127962 TTGGATGCAGGTTGAAACAAGGG + Intergenic
1153280695 18:3411662-3411684 TTGGATGGAGGAAGACACAGAGG - Intronic
1154264762 18:12871034-12871056 TTGGATGGAGGAAGACAGACAGG - Intronic
1155390590 18:25331746-25331768 TTGTTTGAATCAGGAAACACTGG + Intronic
1155464721 18:26121522-26121544 TTGGATGAAAGAGGGCACTCTGG - Intergenic
1155681823 18:28496326-28496348 TTGAATTAAGGAGGTAGCACTGG + Intergenic
1156103269 18:33624654-33624676 TTGGATGACGGTGCAGACACAGG - Intronic
1156605879 18:38666559-38666581 TTGAAGGAAGGAAGAAACACAGG - Intergenic
1157088360 18:44605362-44605384 TTGCATGAATGAGTAGACACAGG - Intergenic
1157767015 18:50307106-50307128 CTGGAGGAAGGATGAAAGACTGG - Intergenic
1159708276 18:71719831-71719853 TTTGATGAAAATGGAAACACTGG + Intergenic
1159736188 18:72100749-72100771 TTGTATGAAAGAGGAGACAATGG + Intergenic
1159969720 18:74634710-74634732 GAGGGTGAAGGAGGAAACGCAGG + Exonic
1160502614 18:79409863-79409885 TGGGATGAATGAGTAAAAACAGG + Intronic
1162327544 19:10007807-10007829 TTGGAGGCAAGAGGAAACAGAGG - Intronic
1163265176 19:16216486-16216508 TTGGAGGAAAGAGGACACTCTGG + Intronic
1163324191 19:16592635-16592657 GTGGATGAAGGTGGGGACACTGG - Intronic
1164520622 19:28976490-28976512 CTGGGTGATGGAGGATACACAGG + Intergenic
1166166121 19:40990170-40990192 GCGGATGAAGGAGGGGACACTGG + Intergenic
1166463351 19:43009847-43009869 GTGGATGAAGGAGGAGATCCAGG + Intronic
1167794111 19:51698118-51698140 TTTGATGAATGAGGAAACTGAGG + Intergenic
925879272 2:8338028-8338050 TGAGATGAAGGAGAAAAAACAGG + Intergenic
926644186 2:15271146-15271168 TAGGATAAAGGAGGAAACGGTGG + Intronic
927018181 2:18989947-18989969 TTGAATGAAGGAGTGGACACTGG - Intergenic
927127264 2:20023122-20023144 TGGGATGAAGGGGCTAACACTGG - Intergenic
928230646 2:29495660-29495682 TTTGACAGAGGAGGAAACACAGG + Intronic
929962768 2:46508835-46508857 ATGGATGAAGGTGGAAAGATGGG - Intronic
931222794 2:60303319-60303341 TTTGCTGAAGCAGGAAACACAGG + Intergenic
931289860 2:60862853-60862875 TAGAATGAAACAGGAAACACTGG - Intergenic
933623932 2:84576688-84576710 TTGGATGAGGGAGGAAATGGAGG + Intronic
935129088 2:100247886-100247908 CTGGTGGAAGGAGGACACACCGG - Intergenic
935154325 2:100469663-100469685 TTTTATGAATGAGGAAACAGAGG - Intergenic
935218077 2:100990164-100990186 TAGGTAGAAGGAGGAGACACTGG + Intronic
935553912 2:104486165-104486187 TAAGATGAAGGAGAATACACAGG - Intergenic
935978617 2:108604740-108604762 TTGGATGAAGGATGAAACAGGGG + Intronic
936235731 2:110740987-110741009 TTTTTTGAAGGAGGAAACAAAGG + Intronic
938674090 2:133613476-133613498 TTGAATGGAGGTGAAAACACTGG - Intergenic
939928903 2:148207564-148207586 GTGGAAGAATGAGGAAACACTGG + Intronic
940279636 2:151976143-151976165 TTGGGTGCAGGAGCAACCACAGG - Intronic
940936668 2:159503322-159503344 ATGGATGCAGGAGGAGACAGTGG - Intronic
942445208 2:176072945-176072967 TGGCATGAAGGTGGAAACAACGG + Intergenic
942563114 2:177241270-177241292 TTGGATGAAGGAAGGATCTCAGG - Intronic
943828886 2:192432392-192432414 TGAGATGAAGGAAGAAAGACTGG + Intergenic
945573611 2:211503070-211503092 ATGGATGAATGAAGAAACTCTGG + Intronic
945767199 2:213995777-213995799 TTGGATGAAGGGTGAAACTTAGG + Intronic
946057861 2:216917337-216917359 TTGGATGCAGAAGGAAAGAAGGG + Intergenic
946175916 2:217922010-217922032 TCGGAAGAATGAGGAGACACAGG + Intronic
947350135 2:229235068-229235090 TGGGAGAGAGGAGGAAACACTGG - Intronic
947654983 2:231819343-231819365 GTGGATGAGGAAGGAAACCCAGG - Intergenic
947884257 2:233552670-233552692 TTTGATGAAGGGGCAAAAACTGG + Intronic
948494360 2:238337311-238337333 TTGGGTGAAGGAGGACATGCAGG + Intronic
1168856247 20:1011253-1011275 TTGGAGGAAGTTGCAAACACAGG - Intergenic
1168858731 20:1029418-1029440 TTTTATGGAGGAGGAAACTCAGG - Intergenic
1169472052 20:5894942-5894964 TTGGATGAATAAGGAAAAAGAGG - Intergenic
1169800181 20:9506433-9506455 TTGGAGGAAGGAGGCAGAACTGG - Intergenic
1170133463 20:13048294-13048316 TTTGATGAAGGAACACACACTGG + Intronic
1170492265 20:16889724-16889746 TTGGAGGAAAGAGGACACTCTGG - Intergenic
1170799643 20:19580421-19580443 ATGGAGGCAGAAGGAAACACAGG - Intronic
1170836427 20:19888654-19888676 AGGGATGAATGAGGAAAGACAGG + Intronic
1173707785 20:45125096-45125118 TTGTATGAATGAGGAAACGGAGG - Intergenic
1173900970 20:46588643-46588665 GTGGATGAAGGTGGAAAGAGAGG + Intronic
1173912783 20:46682756-46682778 TTTTATGGTGGAGGAAACACTGG - Intronic
1174326354 20:49781868-49781890 TTGCATGGAGGAGGAAACTGAGG - Intergenic
1174928974 20:54793178-54793200 TTGGATGAAAGAAGATACTCTGG + Intergenic
1176408272 21:6433698-6433720 GTGGGGGAAGGAGGAAACCCAGG - Intergenic
1179683766 21:43042024-43042046 GTGGGGGAAGGAGGAAACCCAGG - Intergenic
1180571250 22:16722499-16722521 TTTGTTAAAGGAAGAAACACAGG + Intergenic
1182578865 22:31291756-31291778 ATCCGTGAAGGAGGAAACACCGG - Intronic
1183280132 22:36927599-36927621 TGGGAAGAAGCAGGAGACACAGG + Intronic
1184830443 22:46982734-46982756 TTGGATGAAGGAGGGGATTCAGG + Intronic
949202908 3:1401626-1401648 TTGGATGCATATGGAAACACTGG + Intronic
949935775 3:9114494-9114516 TGGGATGAAGGGGGAGTCACAGG - Intronic
951370387 3:21839001-21839023 TTGGATGAATGAGGCAACTGTGG + Intronic
951378153 3:21949343-21949365 CAGGATGGAGGATGAAACACAGG - Intronic
951834957 3:26972858-26972880 TTGGATCAAGCAGCACACACTGG - Intergenic
952155934 3:30643641-30643663 TTGGATAAATGAGTGAACACAGG - Intronic
952401949 3:32971401-32971423 TTGGTTGATGGAGGAAGCTCGGG - Intergenic
952727796 3:36606373-36606395 TTGTATTATGGTGGAAACACAGG - Intergenic
952758028 3:36889525-36889547 TGTGATGAAGGAGGGAACAAAGG + Intronic
955241189 3:57179797-57179819 TAGGAGGAAGGAGGAAAACCTGG + Intergenic
955337779 3:58101200-58101222 TTGCAGGAAGGAGGAACCAGAGG + Intronic
955366042 3:58311045-58311067 GAGGATGAAGGAGGAAAAAAAGG - Intronic
955825471 3:62941735-62941757 ATGGATGAATGAACAAACACAGG - Intergenic
956356918 3:68404059-68404081 GAGGATGAATGAGTAAACACAGG - Intronic
956845417 3:73177993-73178015 TTGGAACAAGGAGGCAACATTGG - Intergenic
958605631 3:96355275-96355297 TTGTATGAAGGAAGAAAAATGGG - Intergenic
958660359 3:97059129-97059151 TTGGATGTAGGAGCAAAGAGAGG + Intronic
958702944 3:97616358-97616380 TTGGAGGAAAGAGGACACTCTGG - Intronic
958878744 3:99645386-99645408 TTGGAAGAATGAGGAAAGAAAGG + Intronic
960363250 3:116739879-116739901 TTGAATTAACCAGGAAACACAGG + Intronic
960465297 3:117990357-117990379 TTGGAGGAAGGAGATATCACAGG + Intergenic
960594723 3:119397705-119397727 TTGGATCAAGGAGGAAGAACAGG + Intronic
960789150 3:121407983-121408005 TTGGGTGAAGTATCAAACACAGG - Intronic
961181182 3:124879054-124879076 TTGAATGATTGATGAAACACAGG - Intronic
961490793 3:127255679-127255701 TGGGATGTGGGAGGAAACAAGGG + Intergenic
962335454 3:134526657-134526679 TTGGAGGAAGGAAGATACTCTGG + Intronic
964239548 3:154575042-154575064 TTGGAAAAAGGAGGAAAGAGTGG + Intergenic
965516114 3:169622849-169622871 TTGCTAGAAGGAGGAAAGACAGG + Intronic
965764431 3:172115162-172115184 TTGAAAGAATGAGGAGACACAGG - Intronic
967457441 3:189704521-189704543 TTGGATGAAGAAGAAAACAGAGG - Intronic
967942066 3:194773690-194773712 TTGGATCAAGTAGGATATACAGG + Intergenic
969335339 4:6505486-6505508 AAGGATGAAGGAGGAAGTACAGG + Intronic
971156262 4:24086500-24086522 TTGCATGGAGGAGGCAATACTGG - Intergenic
971353527 4:25873550-25873572 CTGGATGCAGAAGGAAGCACTGG + Intronic
973801115 4:54479847-54479869 TTGGAAGAAGGAAAAGACACTGG - Intergenic
974275424 4:59714291-59714313 TTGGAAGATGAAGAAAACACAGG + Intergenic
976889197 4:90024528-90024550 TTGTATAAAGGAGGAAACTGAGG - Intergenic
981520999 4:145662219-145662241 TAGGCTGAAGGAGGAAAAAGAGG - Intergenic
982971707 4:161996523-161996545 TTGAATGAAGGAGACAAGACGGG - Intronic
983353154 4:166620433-166620455 TTTGAGAAAGGAGGAAATACAGG - Intergenic
983392816 4:167155003-167155025 TTGGATGAATGATTTAACACAGG - Intronic
985825656 5:2188966-2188988 TTGGGTGCCTGAGGAAACACTGG - Intergenic
986542954 5:8866253-8866275 TTGGATGAAGGCTGACACTCTGG - Intergenic
987530723 5:19115605-19115627 TTGGAGGAAAGAGGGCACACTGG - Intergenic
990189047 5:53237676-53237698 TTGAATGAAGCAGTAAATACAGG + Intergenic
991628333 5:68628158-68628180 CTGGATGAAGGAAAAAGCACAGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993228635 5:85203784-85203806 TTGGATGTAAGAGGATACTCTGG + Intergenic
995405220 5:111787142-111787164 TGGGATGTGGGAGGAAGCACAGG - Intronic
995424526 5:112005399-112005421 TTGGATAGAGAAGGAAAAACTGG - Intergenic
995458626 5:112378802-112378824 TTCCAGGAAGGAGGAAACATGGG + Intronic
995934579 5:117493492-117493514 TTGGAAGGAGGAGGAAAAAAGGG - Intergenic
996478841 5:123950294-123950316 ATGGATCAGGGAGGAAACGCAGG + Intergenic
997978951 5:138457346-138457368 TTGGAGGAAGGAAGAATGACAGG + Intergenic
999378628 5:151104479-151104501 TTTGATAGAGGAGGAAACTCAGG - Intronic
999586957 5:153100004-153100026 TTGTATGAGGGAGGAGAGACAGG + Intergenic
999721870 5:154404430-154404452 TTAAACAAAGGAGGAAACACAGG - Intronic
1000394489 5:160759359-160759381 TTGTATCATGAAGGAAACACAGG + Intronic
1000408429 5:160913389-160913411 TTGGATCATGGAGGCCACACTGG + Intergenic
1000698678 5:164421442-164421464 TTGGATGAAAGAGGACACTTTGG + Intergenic
1001894306 5:175365354-175365376 AGGGATGAAGCAGGAACCACCGG + Intergenic
1005072198 6:21872165-21872187 TGGGAAGAAGGAAGAAACAAAGG - Intergenic
1005626973 6:27671752-27671774 TTGTATAAACGAGGAAACAGAGG - Intergenic
1005971371 6:30764466-30764488 TTGGAGGCAGGAGGAAAAACAGG + Intergenic
1007417115 6:41698173-41698195 TTCAAGGAATGAGGAAACACAGG + Intronic
1009395809 6:63199266-63199288 TTTGATGATGGAGGAAACAGAGG - Intergenic
1011247243 6:85332264-85332286 TTATATGAAGCAGGAAAGACAGG - Intergenic
1014462769 6:121717493-121717515 ATGCATGAAGGAGAAAAGACTGG - Intergenic
1014976005 6:127884992-127885014 TAGGTTAAAGGAGGTAACACAGG - Intronic
1015296750 6:131603585-131603607 TTGGGGGTAGGAGGAAACAAGGG - Intronic
1016603871 6:145895790-145895812 TTGGATAGATGAGGAAACACAGG - Intronic
1019883487 7:3883851-3883873 TTGAGTGAAGGAGAAAACGCTGG - Intronic
1021054408 7:16029084-16029106 ATGCATGAAGCAGGGAACACAGG - Intergenic
1022539159 7:31120661-31120683 GTGGATGTAGGAGGAAAGCCAGG + Intergenic
1022837914 7:34134549-34134571 TTTGCTCAAGTAGGAAACACTGG - Intronic
1023246639 7:38211996-38212018 TTGGTTGAAGCTGGAAACAGTGG - Intronic
1023267554 7:38423503-38423525 TTGGATTCAGGAGGTAACAGAGG - Intronic
1023311695 7:38894188-38894210 ATGGATGAAGGAGGAATCTCTGG + Intronic
1023581094 7:41683484-41683506 TTGGATTAATGTAGAAACACTGG + Intergenic
1023705913 7:42941688-42941710 GAGGATCAAGGAGGGAACACTGG - Intronic
1026512706 7:71040321-71040343 TTGTATGAATGAGGACACCCAGG + Intergenic
1027702554 7:81486426-81486448 TTGGAGAAAGAAAGAAACACTGG - Intergenic
1027852544 7:83466714-83466736 TTGGGTGAAGGAGGCAAGAGGGG + Intronic
1028880753 7:95877079-95877101 GTGGATGCAGCAGAAAACACAGG + Intronic
1030316230 7:108117247-108117269 TTAGATAAAGAAGGAAACAAAGG + Intronic
1030452170 7:109725616-109725638 TTGGTAGAAAGAGCAAACACTGG - Intergenic
1031727022 7:125252678-125252700 TTTAATGAAACAGGAAACACAGG - Intergenic
1032761251 7:134945142-134945164 TGTGATTAAGGAGGATACACAGG - Intronic
1033815609 7:145069020-145069042 TTTGATGAAGAAGGAAGAACGGG - Intergenic
1034196457 7:149251989-149252011 TTGGATGAGGCAGGCAGCACAGG + Intronic
1034269870 7:149798258-149798280 TTGGCTCAGGGAGGAGACACTGG + Intergenic
1035797678 8:2374344-2374366 ATGGATGAATGAGGAAAGCCAGG - Intergenic
1035933359 8:3809409-3809431 TTTGATGGAGAAGGAAACAAAGG - Intronic
1036619627 8:10415975-10415997 TTGGAGGAGAGAGGACACACGGG - Intronic
1039274853 8:35924360-35924382 TTGGATGGATGAAGACACACTGG + Intergenic
1039381045 8:37085901-37085923 AGGGAGGAAGGAGGAAAGACTGG - Intergenic
1039381060 8:37085955-37085977 AGGGAGGAAGGAGGAAAGACTGG - Intergenic
1041502780 8:58556626-58556648 ATTAATGAAGTAGGAAACACTGG - Intronic
1042701860 8:71624333-71624355 TTGGAAGAATGAGTAAGCACAGG - Intergenic
1043043684 8:75294224-75294246 TTGGATCAAGATGGAAAAACAGG + Intergenic
1044884318 8:96760346-96760368 CTTTATGGAGGAGGAAACACAGG + Intronic
1045514311 8:102843588-102843610 TTGGATGAAGGAACAAACCTTGG - Exonic
1045977554 8:108146809-108146831 TTGGGAGAAGAAGGAAAGACAGG - Intergenic
1046742187 8:117841396-117841418 TTGGGGGGAGGAGGAAAGACAGG + Intronic
1046997159 8:120535973-120535995 TTGGTTGAAGCAGGAAAGAATGG - Exonic
1047027801 8:120843489-120843511 TTGGATCAGGGAGGACACACAGG - Intergenic
1047346603 8:124034953-124034975 TTTGATAAATGGGGAAACACAGG - Intronic
1048262030 8:132953276-132953298 AGGGAGGGAGGAGGAAACACAGG - Intronic
1048660114 8:136589807-136589829 AAGCATGGAGGAGGAAACACTGG + Intergenic
1049035371 8:140071443-140071465 CTGGAAGAGTGAGGAAACACGGG + Intronic
1049970614 9:818765-818787 GTGGGTGAAGGAGGAAGCATAGG - Intergenic
1050324339 9:4485450-4485472 TTGGATGAAGATGAAATCACAGG - Intergenic
1051146817 9:14035567-14035589 TTGGATGAACGGGGAGACATCGG - Intergenic
1051749144 9:20323395-20323417 TGGCATCAAGGAGGAAATACAGG - Intergenic
1051807952 9:21017142-21017164 GTGGATCAAGGAGAAAAGACTGG + Intronic
1052188892 9:25633182-25633204 TTGGAAAGAGGAGTAAACACTGG + Intergenic
1052652899 9:31326114-31326136 TTGGAGGCAGGAGGAAACCTAGG + Intergenic
1054877445 9:70111727-70111749 TGGCAGGAAGGAGGAAACAGAGG + Intronic
1055327795 9:75150127-75150149 CTGGTTGAAGGTGGACACACGGG + Intergenic
1055437882 9:76310677-76310699 TTGGGGACAGGAGGAAACACAGG - Exonic
1055603906 9:77948496-77948518 ACGGATGAAGGAGGACACAGAGG + Intronic
1058375210 9:104314975-104314997 TTGTATGAATGGGAAAACACAGG - Intergenic
1058763234 9:108156854-108156876 TTTGATGAAAGAGGAAACCAAGG - Intergenic
1058886880 9:109328523-109328545 ATGGAAGAAGGAGGAAACATGGG + Intergenic
1059047025 9:110879889-110879911 TTGGTTGAAGGAGGAAACACAGG + Intronic
1059778982 9:117507196-117507218 TTGGAGGTAAGAGGACACACTGG + Intergenic
1060251320 9:121988558-121988580 TTAGATGAAGCAGGAGAAACTGG - Intronic
1061445691 9:130635973-130635995 GTTGACAAAGGAGGAAACACAGG - Intronic
1062009198 9:134258206-134258228 TTGGAGGCAGGAGGAATCATGGG + Intergenic
1062565847 9:137163666-137163688 ATGGATGAAGGAGAACGCACCGG - Exonic
1203669934 Un_KI270755v1:713-735 GTGGAAGAAGGAGGAAAGAATGG - Intergenic
1186556715 X:10567535-10567557 TTGCCTGAAGATGGAAACACTGG - Exonic
1187234486 X:17454274-17454296 TGGGATGAAGGAATAAACTCAGG + Intronic
1187298192 X:18022954-18022976 TTAGATGATGAAGGAAATACTGG - Intergenic
1187419925 X:19125271-19125293 TGGGATTAAGGAGGGAACCCCGG + Intergenic
1187848835 X:23570357-23570379 TTGAATTAAGGAAGAAACACTGG - Intergenic
1188545746 X:31304752-31304774 TGGGATGAGGGAGGAAACCCTGG - Intronic
1189064439 X:37791950-37791972 TTGGATTAAGGGGGAAAGAATGG - Intronic
1191083459 X:56538303-56538325 TTGGAAAAAGGAGGAAAGAGTGG + Intergenic
1192311907 X:70023647-70023669 TTTGATAAAGGAGGAAAAAAAGG - Intronic
1192571158 X:72206545-72206567 TTTGTTGAAGAAGGAAATACAGG + Exonic
1192793892 X:74411029-74411051 TTGGATGCAGGAGGGGACAAAGG - Intergenic
1192804789 X:74499016-74499038 TTGGATGAAGGAGAAGGCACAGG + Intronic
1192804936 X:74500210-74500232 TTGGATGAAGGAGGAAACACGGG + Intronic
1192887605 X:75352168-75352190 TTGGAGGAAGGAGGGTACTCTGG + Intergenic
1193648717 X:84102710-84102732 TTTGTTGAAGGAGGGAACACAGG + Intronic
1193818586 X:86133276-86133298 TTGTTTAAAGTAGGAAACACAGG - Intergenic
1193960743 X:87922491-87922513 TTGGATGTAGGAGTAAAGAAAGG + Intergenic
1194888342 X:99347435-99347457 TTGGAGGTAAGAGGACACACTGG + Intergenic
1195910068 X:109880467-109880489 CTGGACGAAGGAGGTAACAGAGG - Intergenic
1196101743 X:111854026-111854048 CTGGATGGCGGCGGAAACACTGG - Exonic
1197176536 X:123492202-123492224 TTGGAAGAAGGAGGAAACAAAGG + Intergenic
1197942931 X:131808560-131808582 GTGGATGAAGAAGGAGAAACAGG - Intergenic
1197994238 X:132354946-132354968 TTAGAGAAAGTAGGAAACACTGG + Intergenic
1198414375 X:136405096-136405118 TTGGATGACAAAGGCAACACTGG - Intronic
1198705530 X:139444156-139444178 TTGGAGGAAAGAGGACACTCTGG - Intergenic
1199287531 X:146070403-146070425 TTGGAGAAAGCATGAAACACAGG - Intergenic
1199475958 X:148245537-148245559 TTTTATGCAGGAGGAAACAGAGG - Intergenic
1199881644 X:151978202-151978224 GTGGATGAAGGAGCAAGCAGGGG + Intergenic
1201328180 Y:12789196-12789218 TTGGTTGAAGTTGGAAACAGTGG + Intronic
1201993452 Y:20055657-20055679 CTGCAAGAAGGAGGAAACTCTGG - Intergenic
1201996246 Y:20093387-20093409 TTGCCTGAAGGAAGAAACTCTGG - Intergenic
1203336104 Y_KI270740v1_random:1848-1870 CTGCAAGAAGGAGGAAACTCTGG - Intergenic