ID: 1192805669

View in Genome Browser
Species Human (GRCh38)
Location X:74506398-74506420
Sequence GCTCCCTGCCCCATATCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192805669_1192805680 21 Left 1192805669 X:74506398-74506420 CCTAGTGATATGGGGCAGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1192805680 X:74506442-74506464 CCTCGAGGTAAATCTAGGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 50
1192805669_1192805676 6 Left 1192805669 X:74506398-74506420 CCTAGTGATATGGGGCAGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1192805676 X:74506427-74506449 AGGGGACTGTAAAAACCTCGAGG 0: 1
1: 0
2: 1
3: 4
4: 82
1192805669_1192805677 16 Left 1192805669 X:74506398-74506420 CCTAGTGATATGGGGCAGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1192805677 X:74506437-74506459 AAAAACCTCGAGGTAAATCTAGG 0: 1
1: 0
2: 0
3: 58
4: 1559
1192805669_1192805681 24 Left 1192805669 X:74506398-74506420 CCTAGTGATATGGGGCAGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1192805681 X:74506445-74506467 CGAGGTAAATCTAGGCTGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 132
1192805669_1192805678 20 Left 1192805669 X:74506398-74506420 CCTAGTGATATGGGGCAGGGAGC 0: 1
1: 0
2: 2
3: 15
4: 156
Right 1192805678 X:74506441-74506463 ACCTCGAGGTAAATCTAGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192805669 Original CRISPR GCTCCCTGCCCCATATCACT AGG (reversed) Intronic
900122476 1:1054700-1054722 CCTCCCGGCCCCACAGCACTGGG - Intronic
900331625 1:2137651-2137673 GAGCCCTGGCCCATGTCACTGGG - Intronic
900754080 1:4421505-4421527 TCTCCCTGCCCCCCAACACTGGG + Intergenic
901489886 1:9591297-9591319 GCTACCTGCCCCACATCACCCGG + Intronic
901945668 1:12701653-12701675 GATCCATTCCCCAAATCACTCGG - Intergenic
905534988 1:38714372-38714394 CCACCCTCCCCCATTTCACTGGG + Intergenic
905658112 1:39699336-39699358 GTTCCCTTCCCCAAATCTCTGGG + Intronic
906072740 1:43029023-43029045 GCTACCTGCCCCAGGTCACACGG - Intergenic
912172642 1:107119053-107119075 GCCCCCTGCCCCTTATCCATGGG - Intergenic
912978047 1:114347465-114347487 GATCCCTTCCCCACAGCACTGGG + Intergenic
913166572 1:116192587-116192609 CATCCCTGCCCTTTATCACTGGG - Intergenic
919834841 1:201566386-201566408 GCACCCTGAGCAATATCACTAGG - Intergenic
920080295 1:203368249-203368271 GCGCCTTGCCCCATTTCACCAGG - Intergenic
920293911 1:204944276-204944298 GCTCCCTGCTCCCCAGCACTCGG - Exonic
920385726 1:205569212-205569234 GCTCGCTGCCCCAGATCTCCTGG + Exonic
920693355 1:208163540-208163562 GCTCCCTACCCCATGCCCCTTGG - Intronic
922169706 1:223144029-223144051 GCTCCCTGCCACCTGCCACTTGG + Intergenic
923617320 1:235548597-235548619 GCTTCCAGCCCCATACCAGTCGG - Exonic
923698878 1:236281653-236281675 GTTCCCGGCCCGCTATCACTCGG + Intronic
923795810 1:237154342-237154364 GCTGCCTGCACCAAAGCACTCGG - Intronic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1068033841 10:51735824-51735846 GCCCCCTGCCCCATATCCATGGG - Intronic
1070573205 10:77657215-77657237 GGTCCCTGCTCCATCTCACGAGG + Intergenic
1070771230 10:79083459-79083481 GCTCTCTGTCCCTTATCACCTGG - Intronic
1072485164 10:95847919-95847941 GCTCCAAGCACCATATCACTAGG + Intronic
1072690124 10:97567357-97567379 GCGCCCTGCCCCACATCATGTGG + Intronic
1073235473 10:102011478-102011500 TCTCCTTTCCCCATCTCACTTGG + Intronic
1073249107 10:102111040-102111062 GCTCCCAGCCCCTTTTCCCTTGG + Intronic
1073602557 10:104861268-104861290 GCTCTCTGGCCCATACCACCTGG + Intronic
1073826982 10:107335920-107335942 GCTCCAAGTCCAATATCACTGGG + Intergenic
1074149000 10:110741714-110741736 GCCCCCTGCCCCCCATCACCTGG + Intronic
1074474120 10:113754248-113754270 GCTTCCTCCCCCATCTTACTTGG + Intronic
1075203080 10:120422508-120422530 GCTCCCTTCCCTCTGTCACTTGG - Intergenic
1075558584 10:123450977-123450999 GCTCCCGTCACCAAATCACTCGG + Intergenic
1075912120 10:126133634-126133656 GCTCCCTGGCACCCATCACTGGG + Intronic
1076550196 10:131273160-131273182 GGTCCCTGCCCCATGGCAATGGG + Intronic
1076636612 10:131885345-131885367 GCGCCCTGCCCCAAGTCCCTGGG + Intergenic
1076782393 10:132731446-132731468 CGTCCCTGCCCCATATCAGGCGG + Intronic
1077160216 11:1109265-1109287 GCTCCCTGCCCCACAGCCCGGGG + Intergenic
1077191428 11:1257406-1257428 GCTTCCTGCCCCATCACTCTGGG + Intronic
1077378516 11:2216635-2216657 GCTCCCTGCCCCCTTTCTCCTGG + Intergenic
1079401531 11:20110091-20110113 GCTCCCTGCCCCAGATGGCTGGG - Intronic
1081992093 11:47343371-47343393 GCTCTCAGCCCCATCTCTCTGGG - Intronic
1083167487 11:60899783-60899805 TCTCCCTGCCCCAAATCTTTTGG - Intronic
1084117457 11:67050436-67050458 CCTCCTCCCCCCATATCACTGGG - Exonic
1084555497 11:69873542-69873564 GCTCCAGGCCCCATTTCACCAGG + Intergenic
1084774169 11:71364607-71364629 CCCCCCTGCCCCATAACAATGGG + Intergenic
1089653716 11:119932191-119932213 GCCCCTTGCCTCATATCCCTGGG - Intergenic
1090193213 11:124791593-124791615 GCCCGCTGCCCAATATCAGTGGG + Intronic
1090455506 11:126845226-126845248 GCTCACTGCACCATAGCCCTGGG - Intronic
1091637552 12:2208949-2208971 GATCCCTGCCCCAGACCCCTGGG + Intronic
1093784247 12:23174354-23174376 GGTCCCTCCCCCATAACACGTGG + Intergenic
1094839719 12:34337860-34337882 GCCCCCTGCCGCATATCTTTGGG + Intergenic
1096523969 12:52199776-52199798 GCTCCCCGCCCTATGTCAGTTGG - Intergenic
1100408224 12:94289541-94289563 GCTCCCTGCCTCACAGGACTAGG + Intronic
1100685395 12:96982062-96982084 GCTCTCGGCCCCACATCGCTGGG - Intergenic
1100806347 12:98288300-98288322 GCTCCCTGCCCTACCACACTAGG + Intergenic
1101336261 12:103799657-103799679 GCTTCCTGCCTCATGTCACGGGG - Intronic
1102508167 12:113397164-113397186 TCTCCCTGCCCAAGATCACCAGG - Exonic
1103090862 12:118097173-118097195 CATCCATGCCCCACATCACTGGG + Intronic
1106061992 13:26302387-26302409 GCTCCCAGATCCATATCAATTGG - Intronic
1107311420 13:39082448-39082470 GCTCAGTGCACCATAGCACTGGG - Intergenic
1110511152 13:76352603-76352625 TCTCCCTTCCCCATGTCTCTTGG + Intergenic
1115124053 14:29971576-29971598 TGTCCCCGTCCCATATCACTGGG + Intronic
1116957113 14:50935985-50936007 GCTCCCTGCCCCAAAGTGCTGGG + Intronic
1121271174 14:92639180-92639202 GCTCCCAGCCTCATGTCACCAGG + Intronic
1121494321 14:94381511-94381533 GCTCCCTGCCCCTTGTTAATTGG + Intronic
1125063878 15:35458549-35458571 GATCCCTGACCCATATCATTTGG + Intronic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1129687858 15:77696650-77696672 CCTCCCTGCCCCCTATCTCTGGG + Intronic
1131274383 15:90968742-90968764 GCTCCCTTCCCCATGTGATTGGG + Intronic
1135425007 16:22328093-22328115 GCCCCCTTCCCCATAACTCTTGG - Intronic
1137511093 16:49101513-49101535 GCTTCCTGCCCCATGACTCTGGG - Intergenic
1138489171 16:57366220-57366242 GCCCCCTGCCCCATCTCACAGGG - Intergenic
1141801374 16:86311609-86311631 GCTCCCTACCCCAGAGCCCTGGG - Intergenic
1142251132 16:88992572-88992594 GCCCCCTGCCCAGTATCTCTCGG - Intergenic
1143584723 17:7845393-7845415 GCCCCCTGCCCCAGCTCTCTGGG - Exonic
1144766353 17:17734916-17734938 CCTCCCTGCCCCATGTCAGGTGG - Intronic
1145372056 17:22314809-22314831 ACTTTCTGCCACATATCACTGGG + Intergenic
1146906789 17:36623033-36623055 ACCCCGTGCCCCATATCAGTAGG - Intergenic
1149211950 17:54314286-54314308 GTTCTCTACACCATATCACTTGG - Intergenic
1149602889 17:57904583-57904605 GCTCCCCGTCCCATTTCACAGGG + Intronic
1151390070 17:73780845-73780867 GCTCTCTGCATCATCTCACTTGG + Intergenic
1152569403 17:81115137-81115159 GCGCCCTCCCCCATATCCCCGGG - Intronic
1153268473 18:3295575-3295597 GCTCCCTGCACCTTTTCATTTGG + Intergenic
1155574108 18:27226266-27226288 TCTCCCTGTCCCATCTGACTAGG - Intergenic
1155680507 18:28480998-28481020 GCTTCCTGCCCCGTGTCCCTCGG + Intergenic
1156341993 18:36218085-36218107 GCTCCTTCCACCATATCTCTGGG - Intronic
1166119487 19:40677161-40677183 GCTCCCTGCCCCCTGATACTGGG + Intronic
926122904 2:10254515-10254537 CTTCCCAGCCCCGTATCACTAGG + Intergenic
926205654 2:10833010-10833032 GCTCCCTCCCACCCATCACTTGG - Intronic
929539939 2:42811407-42811429 GCGCCCTGCCCCACATCGCCAGG + Intergenic
929672184 2:43885267-43885289 GCTGCCTGACCCATAGCAGTAGG + Intergenic
931217843 2:60263094-60263116 ACTCCTTGCCCCAGAACACTGGG + Intergenic
931721289 2:65069497-65069519 GCTCCCTCTCCCATAGGACTGGG - Exonic
932087531 2:68775169-68775191 GCTCACTGCCCCATGTCCCTCGG + Intronic
932285320 2:70526568-70526590 GCTCTCTGCCCCACAGCTCTGGG - Intronic
934654438 2:96109946-96109968 ACTCCCTGCCCCAGCTCCCTGGG - Intergenic
935161606 2:100534350-100534372 CCACCCTGCTCCATGTCACTGGG + Intergenic
936027864 2:109047133-109047155 GCTTCCTGCCCTATGCCACTTGG + Intergenic
936882023 2:117265171-117265193 GCTGCCTGCCCCCTTTCCCTAGG + Intergenic
937987679 2:127645825-127645847 CCTCCCTGCCCCCCATCAGTAGG + Intronic
940658757 2:156520345-156520367 GCCTCCTGTCCAATATCACTAGG + Intronic
940991120 2:160097820-160097842 CCTCCCTGCCCTTTTTCACTGGG - Intergenic
941903179 2:170696945-170696967 GCTCGCTGCCCCACATCCCCAGG + Intergenic
941985046 2:171502159-171502181 TCTCCCTTCCCCATAGCCCTTGG + Intergenic
942821658 2:180122489-180122511 ACACCCTGCCACATATCACGTGG - Intergenic
943112438 2:183622299-183622321 GCTACCTGGCTCATCTCACTGGG - Intergenic
946772984 2:223108457-223108479 GCTCCCTGTGCAATCTCACTGGG + Intronic
947248881 2:228079383-228079405 GATCCCTGGCCCACAGCACTAGG + Intronic
1169108033 20:3013957-3013979 GCTTCCTGCCCCATCTTACCAGG - Intronic
1172819188 20:37717579-37717601 AATTCCTGCCTCATATCACTTGG - Intronic
1173859735 20:46275320-46275342 GCTCCTTTCCCCATATCTGTGGG + Intronic
1173908868 20:46649405-46649427 GCTCCCCGCCCCTTAACCCTTGG + Intronic
1175892997 20:62323520-62323542 GCTGCCTGCGCCACACCACTGGG - Exonic
1179932450 21:44579517-44579539 CTTCTCTGCCCCATGTCACTTGG - Exonic
1182481271 22:30610540-30610562 GCACCTTGCCCAATCTCACTTGG - Intronic
1183114921 22:35684431-35684453 GCTCCCTGCTCTATAGCTCTTGG + Intergenic
953141451 3:40232991-40233013 TCTTTCTGCCCCATCTCACTTGG + Intronic
954409515 3:50364385-50364407 CCTCCCTGTCCCATCCCACTGGG + Intronic
956019478 3:64918516-64918538 GCTCCTTGCCCCTTATACCTGGG - Intergenic
956970368 3:74516655-74516677 GATCTCTGCCCCATCTCAATAGG - Intronic
957249564 3:77756539-77756561 GGCCCCTGACTCATATCACTGGG + Intergenic
960006923 3:112790387-112790409 GCTGCCTGCCCCATAACAATAGG - Intronic
960173238 3:114487659-114487681 GCTCCCTGTCCCAGAACACAGGG + Intronic
968904970 4:3446832-3446854 GACCCCTGCCCCTAATCACTGGG - Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
970662084 4:18296603-18296625 GCTTCCTGCTCTATATCACCCGG - Intergenic
973800807 4:54475824-54475846 ACTCCCAGCCCCATCTCCCTTGG - Intergenic
977299873 4:95255573-95255595 GCACCCTGTCTCTTATCACTGGG + Intronic
977591136 4:98828659-98828681 CCTCTCTTCCCCATACCACTAGG + Intergenic
982050883 4:151500491-151500513 GACCCCTGCCCCATGTCACTTGG + Intronic
986608703 5:9546394-9546416 GCTCCCTCCCCCGTCTCACTGGG + Intergenic
989635667 5:43530309-43530331 GCTGCCTTCCCCATCTCTCTGGG - Intronic
990027907 5:51218180-51218202 GCTCCCTGCCCCTCTTCTCTTGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
990695989 5:58417620-58417642 GCTCCCTGACCCACCCCACTGGG - Intergenic
998805878 5:145917602-145917624 GCTCCCTGCTCCACACCTCTGGG - Intergenic
999177329 5:149640544-149640566 GCTGCCTCCCCCACATCCCTGGG - Intergenic
1003164684 6:3665878-3665900 GCTCCCAGCCCCAGAGCTCTGGG - Intergenic
1003833675 6:10043496-10043518 GTTACCTGCCCCATGTCACCAGG + Intronic
1003939707 6:11012065-11012087 GCTGCCTGGCACATATCACTTGG + Intronic
1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG + Intergenic
1007423994 6:41735272-41735294 GCTCCCTGGCCCCTATCCCGTGG - Intronic
1008329827 6:50231623-50231645 GCTCCCTGCCCTATATGAATTGG - Intergenic
1011012026 6:82713541-82713563 CCTCCCTGCCCCATCTCAGAAGG + Intergenic
1013042959 6:106454385-106454407 CCTCCCTGGCCAATATTACTGGG + Intergenic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1019938059 7:4269228-4269250 GCTGCCTGCCCCAGGTCACCCGG - Intergenic
1020896849 7:13951070-13951092 ACTCCATTCCCCATACCACTTGG + Intronic
1023841931 7:44103034-44103056 GCTGCCTGCTCCAACTCACTCGG + Intergenic
1026827853 7:73595435-73595457 GCTCCCAGCCCCCCATCCCTGGG + Intronic
1027181418 7:75942388-75942410 GCTCCCTGACCAATATAACTTGG - Intronic
1030347823 7:108454755-108454777 GCTTCCTGCCTCATTACACTTGG + Intronic
1032433600 7:131882491-131882513 GCTCCCTCCCCCAAGTCACATGG + Intergenic
1038667050 8:29546964-29546986 GCTCCCTACCCCTTGGCACTCGG - Intergenic
1041931618 8:63293562-63293584 ACTCCCTGCCCCATCCAACTTGG - Intergenic
1043043756 8:75295022-75295044 GCTCCCTGCCCTATCTTACAGGG + Intergenic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1055248542 9:74275973-74275995 GCTCCCTGCTCCACAGCACCCGG - Intergenic
1056061988 9:82892973-82892995 CCACCCTTCCCCATATGACTTGG - Intergenic
1057976251 9:99609111-99609133 CCCCCCAGCCCCAGATCACTTGG + Intergenic
1058041543 9:100307652-100307674 CCCCTCTGCCCCAGATCACTTGG - Intronic
1058596421 9:106620868-106620890 TCTCGCTTCCCCATCTCACTTGG + Intergenic
1060745217 9:126126820-126126842 GCTCCGTTCCCCATTTCATTTGG + Intergenic
1060895587 9:127215214-127215236 CCTCCCTGCCCCACAACCCTTGG + Intronic
1060981156 9:127792955-127792977 GCTCCCTGGCCCTTGGCACTTGG - Intergenic
1060996493 9:127877245-127877267 GCTCCCTGCCCCAGAGGACCTGG - Intronic
1061844313 9:133378364-133378386 GCCCCCTGCCCCATAGCACTTGG + Intronic
1186526648 X:10255285-10255307 GCTCCCTGCCCCATTTGATTAGG + Intergenic
1191005835 X:55710984-55711006 GCTTCCTGCACCATAGCCCTGGG + Intergenic
1192466117 X:71357344-71357366 GCTCCCTGCCAAATAGCATTGGG + Intergenic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1193803220 X:85962547-85962569 CCTCTCTGTCCCCTATCACTTGG + Intronic