ID: 1192806085

View in Genome Browser
Species Human (GRCh38)
Location X:74510670-74510692
Sequence CAATAGCTGCAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 285}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192806079_1192806085 16 Left 1192806079 X:74510631-74510653 CCCCTAAATCTTCTAACTCCAAA 0: 1
1: 0
2: 0
3: 18
4: 280
Right 1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 33
4: 285
1192806080_1192806085 15 Left 1192806080 X:74510632-74510654 CCCTAAATCTTCTAACTCCAAAA 0: 1
1: 0
2: 6
3: 34
4: 345
Right 1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 33
4: 285
1192806081_1192806085 14 Left 1192806081 X:74510633-74510655 CCTAAATCTTCTAACTCCAAAAC 0: 1
1: 0
2: 1
3: 55
4: 410
Right 1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 33
4: 285
1192806082_1192806085 -2 Left 1192806082 X:74510649-74510671 CCAAAACTGAAAGTAAATAAACA 0: 1
1: 0
2: 10
3: 135
4: 1615
Right 1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192806085 Original CRISPR CAATAGCTGCAGAGGGAAGC AGG Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
902189711 1:14753815-14753837 CCAGAGCTGCAGAAGGAAACAGG - Intronic
902193358 1:14779340-14779362 GAAAAGCCCCAGAGGGAAGCCGG - Intronic
902574927 1:17371832-17371854 AAATACCTGCAGAGGGCAGTTGG - Intergenic
902624818 1:17670471-17670493 CGATTGCTGGAGGGGGAAGCTGG + Intronic
903083945 1:20837980-20838002 CTCTAGCTGCAGACGGAAGCAGG + Intronic
903190055 1:21651319-21651341 CAACAGCTGCAGAGGCAAAGTGG + Intronic
905392938 1:37649899-37649921 CGAGAACTGCAGATGGAAGCGGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
906318668 1:44803734-44803756 CCCTAGCAGCTGAGGGAAGCCGG + Intronic
907429379 1:54403257-54403279 TACTAGCTGCAGAGGGGGGCTGG + Intronic
907520520 1:55020555-55020577 CCATGGCTGCAGAGTGGAGCTGG + Intergenic
908640469 1:66217425-66217447 CAAGAGCTGCAGTGTCAAGCAGG + Intronic
912567270 1:110597084-110597106 TGAGAGCTGCAGAAGGAAGCAGG - Intronic
912701155 1:111879141-111879163 CAAGATCTGCAGTGGCAAGCTGG - Intronic
912701566 1:111882033-111882055 CAGCAGCTGTAGAGGGAGGCAGG + Intronic
913270456 1:117087954-117087976 CAATACCTGAAGTGGGAATCTGG - Intronic
913700471 1:121369119-121369141 GAATAGCAGCTGTGGGAAGCAGG - Intronic
914041022 1:144049577-144049599 GAATAGCAGCTGTGGGAAGCAGG - Intergenic
914137066 1:144910899-144910921 GAATAGCAGCTGTGGGAAGCAGG + Intronic
914854465 1:151341115-151341137 CAATAGGGTGAGAGGGAAGCAGG + Exonic
914902322 1:151717257-151717279 ATATAGATGGAGAGGGAAGCAGG + Intronic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
916339187 1:163709932-163709954 CAATGGCTTCAGAGGGAAAAGGG - Intergenic
917624340 1:176830555-176830577 AATTAGCTGAAAAGGGAAGCAGG + Intronic
919044188 1:192430612-192430634 CTGAAGCTGCAGAGGGCAGCTGG - Intergenic
919742722 1:200990462-200990484 CAAAAGGAGCAGAGGGAAGTGGG + Intronic
920251004 1:204622424-204622446 AAATAGCTGCAGAGGAAAGTGGG - Intronic
920285162 1:204873880-204873902 CAGGAGCTGCAGTGGGGAGCAGG + Intronic
920487887 1:206387846-206387868 GAATAGCAGCTGTGGGAAGCAGG - Intronic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922469164 1:225865332-225865354 CAATTCCTGCAGATGGAGGCTGG - Intronic
922535473 1:226377298-226377320 CAATACCTGCAGTGGGAAGGAGG + Exonic
922779865 1:228243349-228243371 CAAGGGCTGCAGACGGAGGCTGG + Exonic
1064025716 10:11847209-11847231 CAATAGCTGTAGAGGAAAATGGG - Intronic
1064346779 10:14540043-14540065 CCAGAGCTGCAGAGTGGAGCAGG - Intronic
1065622541 10:27598571-27598593 CAATAGCTTCAACAGGAAGCTGG - Intergenic
1065736285 10:28755547-28755569 CAATAGATGCAAAGAGAAACAGG + Intergenic
1066149962 10:32606049-32606071 CAAAGGCTGCACAGGGCAGCAGG - Intronic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1071102792 10:82059089-82059111 CAAATGCTGCAGAATGAAGCCGG + Intronic
1071268789 10:83987679-83987701 CCATAGCAGCAGAGTCAAGCTGG - Intergenic
1071353558 10:84770280-84770302 CTAGAACTGCAGAGGTAAGCAGG + Intergenic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1074957637 10:118407934-118407956 CACTGGCTGCAGTGGGTAGCAGG - Intergenic
1075295270 10:121269831-121269853 CTTTGGCTGCAGAAGGAAGCAGG - Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1078697944 11:13653230-13653252 CAAGAGCTCCTGAAGGAAGCAGG + Intergenic
1078884641 11:15488344-15488366 CCCTAGCTTCAGAGGGAGGCAGG - Intergenic
1078960423 11:16260834-16260856 GAATAGCTGGAGAGGTAAGTGGG - Intronic
1079149953 11:17889037-17889059 CAATAGATAGATAGGGAAGCAGG + Intronic
1079566093 11:21885088-21885110 GAGTAGTTGCAGGGGGAAGCAGG + Intergenic
1079775518 11:24520943-24520965 CATTAGCTCCAGAGGGAAATAGG + Intronic
1079786538 11:24680276-24680298 CAGAAGCAGCACAGGGAAGCTGG - Intronic
1081220565 11:40455276-40455298 CACTAGTTCCAGATGGAAGCAGG + Intronic
1081977596 11:47245567-47245589 CAGCAGCTGTAGAGCGAAGCGGG + Exonic
1082281833 11:50278873-50278895 AAAGAGCTCGAGAGGGAAGCAGG + Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1085775827 11:79365706-79365728 CAACAGGCACAGAGGGAAGCAGG + Intronic
1086730552 11:90243520-90243542 CAATATCTGTAGAAGGAAGGAGG + Intergenic
1087086970 11:94229754-94229776 CAAGAGGTGCAGAGGGAATTGGG - Intergenic
1087749995 11:101996769-101996791 AAAAAACTGGAGAGGGAAGCAGG + Intronic
1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG + Intronic
1090333615 11:125948738-125948760 CTAGAGCTGCAGTGGGCAGCAGG - Intergenic
1090595683 11:128318926-128318948 CAATAGCTAAAGGGGGGAGCGGG - Intergenic
1091681672 12:2531988-2532010 CAATAGCTGCAGGTGTCAGCTGG - Intronic
1092837941 12:12509623-12509645 CAATAGCTGGAGAAGTAAGACGG - Intronic
1093967511 12:25342748-25342770 CAATAAATGTTGAGGGAAGCTGG - Intergenic
1094487579 12:30937258-30937280 CAATAACTTAAGAGGGAAACAGG + Intronic
1096809164 12:54158765-54158787 AAATAGCTGCAGAAGTAGGCTGG - Intergenic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1100904570 12:99282881-99282903 CAACAGCTGCAGAGAGACTCAGG + Intronic
1101182703 12:102236758-102236780 CAATAGTTGCCGATGGAGGCTGG + Intergenic
1104352413 12:128056391-128056413 AAATGGCAGCAGAGTGAAGCAGG + Intergenic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1109336826 13:61004894-61004916 CAATAGCTGCTAAGAGAACCTGG - Intergenic
1111724035 13:91982065-91982087 AGAGAGCTGGAGAGGGAAGCAGG + Intronic
1113509467 13:110841489-110841511 TAGAAGCTGCAGAGGGAAGATGG - Intergenic
1113781142 13:112978262-112978284 AAACAGCTACAGAGGAAAGCAGG - Intronic
1114567727 14:23644869-23644891 CATCAGCTGCAGAGGCAAGTGGG + Exonic
1114716886 14:24836006-24836028 AAATAGCTGCAGGGAGAAGCAGG + Intronic
1115640836 14:35334651-35334673 CTAAAGCTGTAGAGGGGAGCTGG - Intergenic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1119406574 14:74402877-74402899 AAATTGCTGCACAGGGAAGTCGG - Intergenic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1120328966 14:83063620-83063642 CAAAGGCTGCAGAGAGAAGGAGG - Intergenic
1121281813 14:92704509-92704531 AAATGGCTGTAGAGGAAAGCTGG + Intronic
1121521410 14:94588517-94588539 CAGGAGCTGCAGAGGCGAGCAGG - Intronic
1121626614 14:95389847-95389869 GAATAGCTTCAGCAGGAAGCTGG + Intergenic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1122970062 14:105148853-105148875 CAATGTCTGCAGAGGCGAGCGGG + Exonic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123998976 15:25738965-25738987 CAATACCTGCAGAGACAATCTGG + Intronic
1126385085 15:48086016-48086038 TATTAGCTGCAGAGGGCAGCGGG - Intergenic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1128352728 15:66901875-66901897 CTTGAGCTGCAGAAGGAAGCAGG - Intergenic
1128800141 15:70492130-70492152 TAATGGCTGCAGAGGCAAGACGG + Intergenic
1131251903 15:90836579-90836601 GAAGAGCTGAAAAGGGAAGCTGG + Intergenic
1131858468 15:96625447-96625469 CAACAGCTGAAGTGGGAAGCAGG - Intergenic
1133148320 16:3807296-3807318 AAAGAGCTGCAGAGGGCACCAGG + Intronic
1133330823 16:4972492-4972514 TAATAGCAGCAGTGGGGAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134847341 16:17451034-17451056 TAATAACTGCAGAGGGACTCTGG + Intronic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1138044222 16:53704076-53704098 GAATAGCTCCAGACGGGAGCAGG + Exonic
1138341157 16:56289891-56289913 CAAGAGAGGCAGTGGGAAGCTGG - Intronic
1138343746 16:56307424-56307446 CAAAATCTGCTGAGTGAAGCTGG - Intronic
1139284168 16:65796029-65796051 CAATAAGGGCAGAGAGAAGCAGG - Intergenic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1140830782 16:78748715-78748737 AAATAACTGCAGAGGGAATGAGG - Intronic
1140867218 16:79073678-79073700 CTCTAGCTGCAAAGGCAAGCAGG - Intronic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1145043777 17:19596330-19596352 CACGAGCTGCAGAGGGCAGGAGG - Intergenic
1145819119 17:27817783-27817805 CAATATGTGCAGAAGGAAGGAGG + Intronic
1145840660 17:27991323-27991345 CAACAGCTGCATAGGTTAGCTGG - Intergenic
1145879569 17:28343510-28343532 CAAAAACCGCAGAAGGAAGCAGG - Intronic
1147746080 17:42695504-42695526 CAATATCTGCAGGTAGAAGCAGG - Exonic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148457384 17:47818353-47818375 CAGTAGCTGCTGTTGGAAGCTGG + Exonic
1149596816 17:57869082-57869104 GAAAAGCTGGGGAGGGAAGCGGG + Intronic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1151210238 17:72538990-72539012 CTAGAGCTGCAAAGGGCAGCGGG - Intergenic
1151620716 17:75243253-75243275 CAAGACCTGCAAAGGGTAGCAGG + Intronic
1152727210 17:81953262-81953284 CAGTGGCTGCAGAGGAAAACCGG + Exonic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1155393214 18:25359302-25359324 AAATAAATGCAGAGGCAAGCTGG - Intergenic
1158551876 18:58443138-58443160 CACTAGCTGCAGCTGGAAGCAGG - Intergenic
1158878724 18:61755830-61755852 GCAGAGCTGCAGAGGTAAGCTGG + Intergenic
1160918705 19:1509964-1509986 AAACAGGGGCAGAGGGAAGCAGG - Intronic
1163056835 19:14726232-14726254 CAAAGGCTGCACAGGGCAGCGGG + Intronic
1163842064 19:19617650-19617672 CAATAACTGGATAGGGAACCGGG - Intronic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165133437 19:33647888-33647910 AGATAGCTGCTGAGGGAAGAGGG + Intronic
1165137663 19:33680071-33680093 CAATACCTGCAAAGGGAAAAGGG - Intronic
926608217 2:14918743-14918765 CCATGGCTGCAGTGGGAAACAGG + Intergenic
927296931 2:21465470-21465492 CAAAAGCTGCAGAGGGATTTGGG + Intergenic
927352795 2:22137554-22137576 CAATAGCAAGAGAGGGAAGTAGG + Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
930116728 2:47724596-47724618 CAAGAGCTGGGGAGGGAACCAGG - Intronic
931065025 2:58576187-58576209 CAGAAGCTCCCGAGGGAAGCTGG + Intergenic
933808430 2:86017026-86017048 CAAAGGATGCAGAGAGAAGCTGG + Intergenic
934474591 2:94586042-94586064 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
934780126 2:96964691-96964713 CAGTAGCTGAAAAGGGAAGTGGG - Intronic
934893727 2:98093129-98093151 CAGCAGCTGCAGAGGCAAGAGGG + Exonic
935854615 2:107260473-107260495 AAATAGCTACAGAAGGAAGGTGG + Intergenic
939448993 2:142348201-142348223 CAAAAGTTGAAGAGGTAAGCAGG - Intergenic
943840882 2:192579030-192579052 TAATAGCTGCAGAGGGGACTTGG + Intergenic
945853307 2:215035803-215035825 CAAAAGCTGGAGAAGTAAGCAGG - Intronic
946018188 2:216620915-216620937 GAAAAGCTGCAGCAGGAAGCAGG + Intergenic
946247640 2:218396622-218396644 CAAGCGCTGCAGAGGGTACCTGG + Exonic
948099955 2:235365582-235365604 CAAGAGCTGCTGTGGGAAGGGGG + Intergenic
948360343 2:237415677-237415699 CTGGAGCTGCAGAGGGGAGCAGG - Intergenic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
1171187103 20:23130313-23130335 CTATAGCAGCAGGCGGAAGCAGG + Intergenic
1172513597 20:35517133-35517155 GAATAGGTCCAGAGGGAGGCAGG - Exonic
1172896285 20:38302634-38302656 TAGTTGCTGCAGATGGAAGCAGG + Intronic
1173225699 20:41161388-41161410 CAGTAGCTGGAGAGCTAAGCAGG + Intronic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1175689033 20:61052651-61052673 CAGCTGCTGCACAGGGAAGCTGG - Intergenic
1175878395 20:62242221-62242243 CAAGAGCTGCAGAGGTGGGCCGG - Intronic
1175902190 20:62364358-62364380 CACGAGCAGCAGAGGGAAGCTGG + Intronic
1176100526 20:63362371-63362393 CAGTGGCTGCTCAGGGAAGCTGG - Intronic
1176129498 20:63490730-63490752 CAATGCCTGCAGAGGGGAGGGGG + Exonic
1176152799 20:63601415-63601437 CCATAGCTGAAGAGAGAAGTAGG - Intronic
1177370565 21:20198089-20198111 AAATAGGTGCAGAGAGAGGCTGG + Intergenic
1183445950 22:37855042-37855064 TAATAGCTGCTGAGGGCATCAGG + Intronic
1184330813 22:43826327-43826349 CCACAGCCTCAGAGGGAAGCTGG - Intronic
1185193009 22:49450710-49450732 CAACAGCTGCAGAGAAAAGAAGG + Intronic
949618918 3:5788036-5788058 AAATAACTGCAGAGGGAGGGAGG - Intergenic
949772055 3:7589715-7589737 CAACAACTGCAGTGGGAAGCTGG - Intronic
949919564 3:8990457-8990479 CAAAAGCCCCAGAGGGCAGCGGG - Intronic
949996105 3:9618779-9618801 CAAGGGCTGCAGAGAGTAGCAGG - Intergenic
952289214 3:31999172-31999194 CAAGAGCTGCAGTGGCAATCAGG + Intronic
952458513 3:33499184-33499206 GGAGAGCTGCAGAGCGAAGCGGG - Intronic
952735749 3:36690113-36690135 CAATAGAGGCAGGGGGAAGAGGG + Intergenic
953046643 3:39298719-39298741 CAGTAGCTGCAGTGGCAGGCTGG - Intergenic
953244298 3:41176737-41176759 GAACAGCTGCAGAGACAAGCAGG - Intergenic
953284765 3:41595915-41595937 GAATAGCTGCAGAGGGATGTGGG + Intronic
953784793 3:45903265-45903287 CAATTGCAGTAGAGAGAAGCAGG - Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
955747792 3:62157111-62157133 TAATAGCTGCCCAGGGATGCAGG - Exonic
959515465 3:107261625-107261647 CGGTAGCTACAGAGAGAAGCAGG + Intergenic
961787004 3:129353375-129353397 CAATAGGTGCATGGGGAAGGTGG + Intergenic
961861277 3:129918456-129918478 CAACAGCTGTGGAGAGAAGCCGG + Intergenic
962788082 3:138785670-138785692 CAAACGCTGCGGAAGGAAGCAGG + Intronic
963677205 3:148327301-148327323 CAATAGCTGCAGGGGGATTGGGG - Intergenic
963680541 3:148370076-148370098 CATTACCTGCAGAGGGAACTGGG + Intergenic
965074908 3:163963898-163963920 CAGCAGCTGCATAGGGCAGCGGG - Intergenic
965488948 3:169313338-169313360 CAATAGCTGGAGTGGTAAGTAGG + Intronic
966828240 3:183983625-183983647 CACCACCTGCAGAGGGAAGGCGG + Intronic
968149217 3:196323936-196323958 CAACAGCTGCAGAGGGCTCCAGG + Exonic
969087171 4:4665169-4665191 CAAGAGCTTCAGAGGGAACATGG - Intergenic
969126390 4:4951353-4951375 AATTAGCTGCAGAGAGAAACTGG - Intergenic
970681135 4:18509641-18509663 CAAAAGCTGCAGATAGAAGTGGG + Intergenic
971933308 4:33114811-33114833 TAATAGCTACAGATGGATGCAGG - Intergenic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
976627673 4:87204677-87204699 CAATGGCTGCTGAGTGAAACAGG + Intronic
978628126 4:110711004-110711026 CATCTGCTGCAGAGGGAAGTTGG - Intergenic
979981177 4:127257127-127257149 AAATGACTGCAGATGGAAGCTGG + Intergenic
980789988 4:137608073-137608095 CAAAAGCTGCAGGGGGAGTCAGG + Intergenic
981799074 4:148635242-148635264 CAAAATCTGCAGAGAGAAGCAGG + Intergenic
983491802 4:168398134-168398156 CCAAACCTGCAGAGGGAAGGGGG - Intronic
983572460 4:169224681-169224703 CAGTAGCTGCAGGGGTAACCAGG + Intronic
983616213 4:169708164-169708186 CAATGGCCACAGAGGTAAGCTGG - Intronic
983801264 4:171932436-171932458 GAACAGCTGCACAGGGAAGCTGG + Intronic
992436901 5:76763177-76763199 CATGAGCTGCAGAGGGGAGAAGG - Intergenic
993274280 5:85836164-85836186 CAAAAGATTCAGAGGCAAGCAGG + Intergenic
995236085 5:109832315-109832337 CAAAAACTGCAGAAGGCAGCAGG - Intronic
996851328 5:127956603-127956625 TAAGTGCTGGAGAGGGAAGCAGG + Intergenic
997620849 5:135292717-135292739 CAATATCTGCAGAAGGCAGATGG + Intronic
997661345 5:135591559-135591581 CAAGCGCTGCAGAAGAAAGCAGG - Intergenic
998232177 5:140367708-140367730 CACTACCTGCAGAAGGGAGCTGG + Exonic
998819401 5:146044661-146044683 CGATAGCTGCAGAGGGACAGAGG - Intronic
999174451 5:149622027-149622049 CAAGTGCTGCAGAGGGCAGAGGG + Exonic
1000567484 5:162867711-162867733 CAGTAGATGAAGGGGGAAGCAGG - Intergenic
1000618532 5:163457569-163457591 CAATAGCTGATGAGGGAACATGG - Exonic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001441061 5:171743394-171743416 CTATAGCTGAAGTGGGAAGATGG - Intergenic
1002595115 5:180317195-180317217 CACTACCATCAGAGGGAAGCAGG + Intronic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003359038 6:5406011-5406033 AAATAGCTGGAGGGGGAAGGTGG - Intronic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1005316105 6:24604268-24604290 CAATGGCTGCAGATGGAAGATGG - Intronic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005691849 6:28314169-28314191 CAAGAGTTGGAGAGGGGAGCTGG + Intergenic
1006125867 6:31837693-31837715 CATAAGGTACAGAGGGAAGCAGG + Intronic
1006629942 6:35423929-35423951 GGATAGCTGCACAGGGAAGGGGG - Exonic
1006807321 6:36797199-36797221 CAATAACTGCAGTGTGAACCGGG - Intronic
1007081637 6:39109262-39109284 ATATGGCTGGAGAGGGAAGCAGG + Intronic
1007212581 6:40207246-40207268 CAATAAGTGTAGAAGGAAGCAGG - Intergenic
1009943153 6:70312975-70312997 AATTAGATGCAGAGTGAAGCGGG - Intergenic
1010505921 6:76659203-76659225 CAATATTTGGAGAGGGAAGTGGG + Intergenic
1014524529 6:122486190-122486212 CAATTTCTGCAGAAAGAAGCTGG - Intronic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019447029 7:1076642-1076664 GAAAAGCCGCAGAGGGAAGCTGG + Intronic
1020093950 7:5357271-5357293 CTTTAGCTGGAGAGGGAAGGTGG + Exonic
1022119723 7:27296512-27296534 AAATAACTACAGTGGGAAGCCGG + Intergenic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1023068778 7:36406437-36406459 CAATAGCAGCAGTGTTAAGCAGG + Exonic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1025242840 7:57292196-57292218 CCATAACAGCAGAGAGAAGCTGG - Intergenic
1027556775 7:79673844-79673866 GAATAGCTATAGAGGGAAGCAGG + Intergenic
1029058066 7:97767461-97767483 CAATAACAGCAGAAGGAAGATGG - Intergenic
1030837466 7:114307454-114307476 CAATAATTGCAGGGGGAAACAGG + Intronic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1032280071 7:130492795-130492817 GAATCGCACCAGAGGGAAGCCGG - Intronic
1033375785 7:140760576-140760598 TAATAACTGAAGAGAGAAGCAGG + Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035856639 8:2982832-2982854 CAACAGCTGGAGAAGGAACCTGG - Intronic
1038490330 8:27965992-27966014 CAGTAACTGCAAAGGGCAGCAGG + Intronic
1038610974 8:29059982-29060004 CAAGAGCTGGAGAGAGAAGATGG - Intronic
1039565934 8:38552729-38552751 GAAGAGCTGCAGTAGGAAGCTGG - Intergenic
1041942611 8:63405332-63405354 TAAGAGCTGCAGAGCTAAGCAGG - Intergenic
1042313801 8:67404531-67404553 CAATACCTGCAAAGGGGAGGAGG - Intergenic
1042651399 8:71045888-71045910 CAGTAGCTGCAGAAGGAAAGAGG + Intergenic
1042868489 8:73376925-73376947 CTATAGCTGGGGAGGGGAGCTGG + Intergenic
1044034978 8:87290388-87290410 CAATAGCAGCATAAGAAAGCAGG - Intronic
1045544267 8:103114024-103114046 CCATCTCTGCAGTGGGAAGCTGG + Intergenic
1047568192 8:126069266-126069288 AAGTAGCTTCAGAGGGAATCTGG + Intergenic
1049363712 8:142226441-142226463 CAATAGGGGCAGACGCAAGCAGG - Intronic
1049592604 8:143469399-143469421 CCACAGCTGCAGTGGGCAGCTGG - Intronic
1050583972 9:7090728-7090750 CTATACCTGCTGAGGGAAGGAGG - Intergenic
1050672864 9:8017506-8017528 AAATAGCTTCAAAGGAAAGCAGG + Intergenic
1053293133 9:36895177-36895199 CGAGAGGCGCAGAGGGAAGCAGG + Intronic
1053683477 9:40500059-40500081 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1053933457 9:43128374-43128396 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054280238 9:63124869-63124891 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1054296581 9:63335557-63335579 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054394598 9:64640062-64640084 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054429247 9:65145261-65145283 AAAAATCTGCAGAGGGAAGAGGG - Intergenic
1054501137 9:65876274-65876296 AAAAATCTGCAGAGGGAAGAGGG + Intergenic
1055017233 9:71632035-71632057 CAATAGCTGCTTTGGGAAGTGGG + Intergenic
1055949169 9:81714667-81714689 CAAGAGCAGAAGAGGGAACCAGG + Intergenic
1056628860 9:88276153-88276175 CAACAGATGCAGAAAGAAGCTGG + Intergenic
1057023038 9:91715329-91715351 CACAAGCTGCAGAGGAACGCAGG + Intronic
1058804351 9:108576848-108576870 CAAGTGCTGCAGAGGGAAGGTGG - Intergenic
1059503426 9:114776431-114776453 AAGTGGCTGCAGAGGGAAGTGGG + Intergenic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1186038480 X:5449880-5449902 CAATAGCTGCATAGAGTAGATGG + Intergenic
1186602272 X:11050360-11050382 CAGTTGCTGCTGAGGGATGCGGG + Intergenic
1187359886 X:18616149-18616171 CAATAGCTATGGAGAGAAGCAGG + Intronic
1187519313 X:19999930-19999952 CAATTTCTGGTGAGGGAAGCTGG + Intergenic
1188465356 X:30473362-30473384 CAAAAGCTGGGAAGGGAAGCAGG + Intergenic
1188654520 X:32674740-32674762 CAAGATCTGCTGAGGGAAGCCGG + Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190118102 X:47638889-47638911 CCTTACCTGCAGAGGCAAGCCGG + Exonic
1190145865 X:47891217-47891239 CAATAGCTGCATAGGGTACCAGG + Intronic
1192011545 X:67278245-67278267 AAACAGCTGGAGGGGGAAGCAGG - Intergenic
1192176255 X:68887385-68887407 AAATAGCTTAAGAGGGAGGCAGG - Intergenic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1193513174 X:82431426-82431448 CAAAAGCTGTAGAGAGTAGCAGG - Intergenic
1195053258 X:101117746-101117768 TAATAGCTACAAAGGGAGGCAGG - Intronic
1195949396 X:110251605-110251627 CAATGGCTTCAAAGGGAAGCAGG + Intronic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1199189345 X:144951963-144951985 CCAAAGCTGCACAGGGCAGCAGG + Intergenic
1199220569 X:145311330-145311352 CAAAGGCTGCACAGGGAAGTGGG + Intergenic
1199220664 X:145312195-145312217 CAATAGGTGAAGGGGGAAGCAGG + Intergenic
1199442297 X:147882579-147882601 GAATAGCTTCAGAGGGAAAAAGG - Intergenic
1199607177 X:149586386-149586408 GAAGATCGGCAGAGGGAAGCGGG - Intronic
1199631947 X:149782982-149783004 GAAGATCGGCAGAGGGAAGCGGG + Intronic
1199742941 X:150752416-150752438 CTCTAACTGCAGTGGGAAGCAGG - Intronic
1201633009 Y:16090931-16090953 CAATAGCTGCATAGAGTAGATGG - Intergenic