ID: 1192810378

View in Genome Browser
Species Human (GRCh38)
Location X:74542024-74542046
Sequence CTTCAAGTTCAGAATGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192810378_1192810382 3 Left 1192810378 X:74542024-74542046 CCATGCACATTCTGAACTTGAAG No data
Right 1192810382 X:74542050-74542072 CCATCTACTCTATCAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192810378 Original CRISPR CTTCAAGTTCAGAATGTGCA TGG (reversed) Intergenic
No off target data available for this crispr