ID: 1192810382

View in Genome Browser
Species Human (GRCh38)
Location X:74542050-74542072
Sequence CCATCTACTCTATCAACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192810377_1192810382 21 Left 1192810377 X:74542006-74542028 CCAGGCTGCTCTGCTCATCCATG No data
Right 1192810382 X:74542050-74542072 CCATCTACTCTATCAACCCTAGG No data
1192810376_1192810382 22 Left 1192810376 X:74542005-74542027 CCCAGGCTGCTCTGCTCATCCAT No data
Right 1192810382 X:74542050-74542072 CCATCTACTCTATCAACCCTAGG No data
1192810378_1192810382 3 Left 1192810378 X:74542024-74542046 CCATGCACATTCTGAACTTGAAG No data
Right 1192810382 X:74542050-74542072 CCATCTACTCTATCAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192810382 Original CRISPR CCATCTACTCTATCAACCCT AGG Intergenic
No off target data available for this crispr