ID: 1192814829

View in Genome Browser
Species Human (GRCh38)
Location X:74579445-74579467
Sequence CATGAATCCAGCTGCTAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192814829_1192814831 -6 Left 1192814829 X:74579445-74579467 CCAAGTTAGCAGCTGGATTCATG No data
Right 1192814831 X:74579462-74579484 TTCATGTACTACAGATAGGTTGG No data
1192814829_1192814830 -10 Left 1192814829 X:74579445-74579467 CCAAGTTAGCAGCTGGATTCATG No data
Right 1192814830 X:74579458-74579480 TGGATTCATGTACTACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192814829 Original CRISPR CATGAATCCAGCTGCTAACT TGG (reversed) Intergenic
No off target data available for this crispr