ID: 1192814830

View in Genome Browser
Species Human (GRCh38)
Location X:74579458-74579480
Sequence TGGATTCATGTACTACAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192814829_1192814830 -10 Left 1192814829 X:74579445-74579467 CCAAGTTAGCAGCTGGATTCATG No data
Right 1192814830 X:74579458-74579480 TGGATTCATGTACTACAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192814830 Original CRISPR TGGATTCATGTACTACAGAT AGG Intergenic
No off target data available for this crispr