ID: 1192815097

View in Genome Browser
Species Human (GRCh38)
Location X:74582127-74582149
Sequence TTGCATACCAATAAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192815094_1192815097 3 Left 1192815094 X:74582101-74582123 CCCAAGGCAACTTAAAGTGCATT No data
Right 1192815097 X:74582127-74582149 TTGCATACCAATAAGCTGGCTGG No data
1192815095_1192815097 2 Left 1192815095 X:74582102-74582124 CCAAGGCAACTTAAAGTGCATTT No data
Right 1192815097 X:74582127-74582149 TTGCATACCAATAAGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192815097 Original CRISPR TTGCATACCAATAAGCTGGC TGG Intergenic
No off target data available for this crispr