ID: 1192815852

View in Genome Browser
Species Human (GRCh38)
Location X:74591275-74591297
Sequence CTGGAACAAAAACTGGAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 2, 1: 1, 2: 2, 3: 37, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192815848_1192815852 12 Left 1192815848 X:74591240-74591262 CCTATAACGTGGCTTTTAAAATA 0: 1
1: 1
2: 2
3: 33
4: 245
Right 1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG 0: 2
1: 1
2: 2
3: 37
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192815852 Original CRISPR CTGGAACAAAAACTGGAGAA AGG Exonic
901556404 1:10034706-10034728 CTGTAGCTAAAACTGGAGCATGG - Intronic
902863900 1:19265028-19265050 CTGTATAAAAGACTGGAGAAGGG - Intergenic
903343855 1:22672059-22672081 TTGGAACAAAACCTGGAACAAGG - Intergenic
903552072 1:24164541-24164563 CTGGAGCCAAAAGTAGAGAAGGG - Intronic
903702752 1:25262810-25262832 TTGAAACAAAAACGGAAGAAAGG - Intronic
903712018 1:25333136-25333158 TTGGAACAAAAACGGAAGAAAGG - Intronic
904536038 1:31200118-31200140 CTGGAAGAAAGACAGGAGAGAGG - Intronic
905181025 1:36166746-36166768 GGGGAACAAAGACTGGAGCAGGG + Intronic
905993418 1:42359841-42359863 CTGAAACAAAATCTGGAAAGTGG + Intergenic
906812139 1:48838419-48838441 CAAGAACAAACATTGGAGAAAGG + Intronic
906904025 1:49868413-49868435 CTGGTACAAAAACAGGCCAATGG + Intronic
907058947 1:51401358-51401380 CAAGAACACAAAATGGAGAAAGG + Intronic
907398312 1:54207987-54208009 CTGGAAAAACACCTTGAGAATGG - Intronic
907617986 1:55944220-55944242 CTGTAGCCAAAAATGGAGAAAGG + Intergenic
908197538 1:61759790-61759812 CTGAAAGAAAAACTGGCAAAGGG - Intronic
908582786 1:65534595-65534617 ATGGAAAAAAAACTAGAGCAAGG + Intronic
908803234 1:67902323-67902345 CAGAAACATAAAGTGGAGAAAGG - Intergenic
908872677 1:68632037-68632059 CTGGATCAATCACTGTAGAAAGG - Intergenic
909119039 1:71576907-71576929 CTGGAACAAAAATCATAGAAGGG + Intronic
910051452 1:82978825-82978847 CTGCCTCAAAAACAGGAGAAGGG - Intergenic
910323930 1:85981814-85981836 CTGGGCTAAAAATTGGAGAAAGG + Intronic
910571827 1:88714041-88714063 CAGAAACAAGAAATGGAGAAAGG - Intronic
910823548 1:91379667-91379689 GTGTAACTAAAAGTGGAGAAAGG + Intronic
910852645 1:91663877-91663899 CTGAGACAGAAACTGTAGAATGG - Intergenic
910985583 1:93002053-93002075 GTGGAACAAAGAATGGAAAATGG - Intergenic
912310985 1:108621259-108621281 ATGGAACAAAAACTGGCACATGG + Intronic
912762035 1:112376879-112376901 CAGGAACATACACTGGGGAAAGG - Intergenic
913463306 1:119112766-119112788 CCAGAACAAAAACTGGAAATGGG - Intronic
913687129 1:121243050-121243072 CTGGAAAAATAACTGTGGAATGG + Intronic
914038987 1:144030688-144030710 CTGGAAAAATAACTGTGGAATGG + Intergenic
914150466 1:145037239-145037261 CTGGAAAAATAACTGTGGAATGG - Intronic
914263431 1:146018829-146018851 CTGGAACATAAATAGGAGAAGGG - Intronic
914437663 1:147673967-147673989 ATGGGAGCAAAACTGGAGAAAGG + Intergenic
914452489 1:147805087-147805109 TTGGAGCAAAAACTGGAGGGAGG + Intergenic
915064002 1:153209889-153209911 CTGGAGTAAGAACTGGAGGAAGG - Intergenic
915160942 1:153920321-153920343 CTGGCAAAAAAAGGGGAGAAGGG + Intronic
915776489 1:158493625-158493647 CTAGGCCAAAAACTGGAAAAGGG - Intergenic
916041453 1:160965113-160965135 TGGGAAAAAAAACTGGACAAAGG + Intergenic
916048661 1:161019725-161019747 CTGGATCAAAGAATGGAAAAAGG + Intronic
916766765 1:167868426-167868448 CTAGGACAAAAACTGTATAATGG + Intronic
916790531 1:168121333-168121355 CCGCAACAAAAACTGCAGAGGGG - Intronic
918646854 1:186915802-186915824 CTGGGACAGAAACTGTATAATGG - Intronic
919064252 1:192673247-192673269 TTGGAACAAGAGCTGGAGAAGGG + Intergenic
919089652 1:192962590-192962612 CTGCTCCAAAAATTGGAGAAGGG + Intergenic
919226997 1:194717149-194717171 CAGTAACAAAGAGTGGAGAAAGG + Intergenic
919412230 1:197259818-197259840 CTGGAAGATAAACTGTACAAGGG + Intergenic
919525819 1:198649076-198649098 CTGGAATAAAAAGTGTAGGATGG - Intronic
920474457 1:206261571-206261593 CTGGAAAAATAACTGTGGAATGG + Intronic
920778060 1:208959855-208959877 CTGGAAGAAAACCTAGAGAAAGG + Intergenic
920858559 1:209685705-209685727 CTGAAACAAAAACTGGATTTGGG - Intergenic
921413101 1:214857869-214857891 CTGGGAAAAAAAATGTAGAAAGG + Intergenic
921583399 1:216921761-216921783 CTGGAATAAAAACTTCAGGAGGG + Intronic
922917799 1:229272360-229272382 CTGCAACAAATACTGTGGAATGG + Intronic
923155462 1:231274610-231274632 CTGAAACATAAACTGTAGGAAGG + Intronic
923373336 1:233334572-233334594 CTAGAATGAAAAGTGGAGAAAGG + Intronic
923983158 1:239349518-239349540 CAGAAACAAAACCTGAAGAATGG - Intergenic
924877759 1:248124373-248124395 CAAAAACATAAACTGGAGAAAGG - Intergenic
1063680363 10:8181570-8181592 CTGGAAGAATAACGGGAGCATGG - Intergenic
1063912329 10:10844092-10844114 CAGGAACAAAGATAGGAGAAAGG - Intergenic
1064540085 10:16396405-16396427 CAGAGACAAAACCTGGAGAAGGG - Intergenic
1064753425 10:18554605-18554627 GTGGAAAAAGGACTGGAGAATGG + Intronic
1064754275 10:18560416-18560438 ACGGAACAGAAAATGGAGAATGG + Intronic
1064755356 10:18568049-18568071 ATGGAACGGAAAATGGAGAATGG - Intronic
1065341352 10:24709434-24709456 CTGATACCAAAACTGGAAAAGGG + Intronic
1066678331 10:37912165-37912187 CTGGTTAAAAAACTGGACAAAGG - Intergenic
1066704251 10:38160230-38160252 CTGGTTCATTAACTGGAGAATGG + Intergenic
1066759815 10:38740100-38740122 CTGGAACAAAGACAGGGCAAAGG - Intergenic
1067746656 10:48941338-48941360 CTGGAACATACACTGGAAACTGG + Intronic
1067813943 10:49456912-49456934 CTGAGACAAAAACTGGAACAAGG + Exonic
1068099972 10:52540295-52540317 CTGGAACAAAAAATTTAAAAAGG + Intergenic
1068444019 10:57096419-57096441 GTGGAACAAAACTTGGACAAAGG + Intergenic
1068456645 10:57263881-57263903 CTGGAATATAAACTCGATAAGGG - Intergenic
1068845918 10:61673630-61673652 CTGGAAGAAAAATCCGAGAAGGG + Intronic
1069917195 10:71794792-71794814 CTGGAACATATACTGGGTAATGG - Intronic
1071207318 10:83296321-83296343 CAAGAACAAGAAATGGAGAAAGG + Intergenic
1071481854 10:86070528-86070550 CTGGAACAGGAGCTGGTGAAGGG + Intronic
1071535189 10:86422776-86422798 CAGGAACATACATTGGAGAAAGG + Intergenic
1071605882 10:86988745-86988767 CAAGAACATAAATTGGAGAAAGG - Intergenic
1071751102 10:88477146-88477168 TTAGAACAAGAACTGGAAAATGG + Intronic
1071752517 10:88496499-88496521 CTTGAACCAGAATTGGAGAAAGG + Intronic
1072196954 10:93124383-93124405 GTATAACAAAAACTGAAGAATGG + Intergenic
1072665268 10:97388222-97388244 CAGGCCCAAAAGCTGGAGAAAGG - Intronic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1072940486 10:99759528-99759550 CATGAACAAAAACAAGAGAAGGG + Intergenic
1074644351 10:115429158-115429180 CAGCAACAAAAACTGAAAAAAGG - Intronic
1075187960 10:120280099-120280121 CTGGTACAAAAACAGATGAATGG + Intergenic
1076268336 10:129129004-129129026 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268344 10:129129047-129129069 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268353 10:129129090-129129112 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268362 10:129129133-129129155 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268371 10:129129176-129129198 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268380 10:129129219-129129241 CTGGAGCAATCACTGGGGAAGGG - Intergenic
1076268389 10:129129262-129129284 CTGGAGCAATCACTGGAGAAGGG - Intergenic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1077410375 11:2401053-2401075 CTGGCACATATAGTGGAGAAAGG + Intronic
1077759777 11:5081144-5081166 CAAGAACAAACACTGGGGAAAGG + Intergenic
1078348718 11:10574655-10574677 CTGGAAAAAAAACTAGTGAGTGG + Exonic
1079620793 11:22551645-22551667 CTGGACCAAAACCTTGACAAGGG + Intergenic
1080357361 11:31465675-31465697 CAGGAACATACACTGGAGAAAGG + Intronic
1081192728 11:40123970-40123992 CAAGAACATACACTGGAGAAAGG + Intronic
1083197497 11:61097401-61097423 CTGGGACAGAAACTGTATAATGG + Intergenic
1084672325 11:70614679-70614701 CTGAGACAAAGACTGGAGGATGG - Intronic
1086218785 11:84416102-84416124 CTGGAGCACAAAATGGAGAAGGG - Intronic
1086740682 11:90364312-90364334 CTGGAATAAAAGCTGGAGACTGG - Intergenic
1087362204 11:97175271-97175293 CAGGAACAAAAATTGAAAAATGG + Intergenic
1087461181 11:98450328-98450350 ATAGAACAAAAGGTGGAGAAAGG - Intergenic
1087493940 11:98864919-98864941 CAAGAACATAAACTGGGGAAAGG + Intergenic
1087790155 11:102397470-102397492 CTGGAATATAAACTGTAAAATGG + Exonic
1088138469 11:106585967-106585989 CAAGAACATACACTGGAGAAAGG - Intergenic
1088232042 11:107682992-107683014 GTGCCACAGAAACTGGAGAAGGG + Intergenic
1088382520 11:109210436-109210458 CCTGATCAAAAACTGGACAAAGG - Intergenic
1088525606 11:110750083-110750105 CAGAAACATAAAGTGGAGAATGG - Intergenic
1088821951 11:113464127-113464149 ATGGAAGAAAAACAGAAGAAAGG - Intronic
1089894591 11:121917280-121917302 CTGGCACAGCAACTGGAGCAAGG - Intergenic
1091180433 11:133599575-133599597 ATGGAGCAAAAGCAGGAGAATGG - Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092837391 12:12503590-12503612 CTGAGACAAAAAGTGGAAAAAGG + Intronic
1093178083 12:15935808-15935830 CTGGGTCAAAAATTTGAGAATGG + Intronic
1093239065 12:16646515-16646537 CTGCAACAAAACATTGAGAAAGG - Intergenic
1095422210 12:42036792-42036814 CAAGAACATACACTGGAGAAAGG + Intergenic
1095980662 12:47972728-47972750 CAGAAACCAAAACTTGAGAAGGG - Intergenic
1097199661 12:57267713-57267735 GTGGAACAAGAACTGGAGTCTGG - Intronic
1097450555 12:59733183-59733205 CTTGAACAAAACTTGGACAAAGG - Intronic
1097744424 12:63285612-63285634 ATAGAACAAAAACAGAAGAAAGG + Intergenic
1098924901 12:76338448-76338470 GTGTAACAAAGACTGGAGGAAGG + Intergenic
1099352383 12:81590009-81590031 CTGGAACATAACCTAGAGACAGG - Intronic
1100129579 12:91474854-91474876 GTGGATAAAAAAGTGGAGAAAGG - Intergenic
1100129717 12:91476517-91476539 TTGGAAAAAAAAGTGGAGAAAGG - Intergenic
1100386505 12:94109140-94109162 CTGGAACTAGGACTGGAGAGGGG + Intergenic
1100599276 12:96099047-96099069 CAGGAACAAATGCTGAAGAAGGG - Intergenic
1100962329 12:99976395-99976417 CTGGCACAAAAACTGGAGCCAGG + Intronic
1100974249 12:100105422-100105444 CAAAAACACAAACTGGAGAAAGG + Intronic
1102576357 12:113858528-113858550 CTGGGACATAAACTGGGGATGGG - Intronic
1102601935 12:114037796-114037818 GTTGAATAATAACTGGAGAAAGG - Intergenic
1102701467 12:114843168-114843190 ATTGAGCAAACACTGGAGAAAGG - Intergenic
1104657286 12:130582716-130582738 CTGAATCAGAAACTGGAGGAGGG + Intronic
1105622281 13:22080032-22080054 CTGGCACATAAACAGGAGAGAGG + Intergenic
1105783431 13:23724295-23724317 ATGGAACAAAAGGTGGAGGAAGG - Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1107016834 13:35714427-35714449 CTGGGAGAAAAACAGGAGAAAGG + Intergenic
1107218546 13:37951806-37951828 CTGAAACAAAAAATGGGAAAAGG - Intergenic
1107782109 13:43914779-43914801 CTGGATCAAAAACTGGGGGTGGG + Intergenic
1108198623 13:48020254-48020276 CTAAAAAAAAAACAGGAGAAAGG - Intergenic
1109803315 13:67404467-67404489 CTGGGACAGAAACTGTATAATGG + Intergenic
1109861933 13:68211482-68211504 AAGGAACAAAAGATGGAGAATGG + Intergenic
1109888507 13:68575450-68575472 CAGAAACAAAAGATGGAGAAGGG - Intergenic
1110161912 13:72388678-72388700 ATGGTACAAAAAGTGTAGAAGGG + Intergenic
1110249225 13:73363155-73363177 CTGGAACAAAAAAAGGACATTGG + Intergenic
1110266186 13:73540573-73540595 ATGAAACAAAAACTACAGAATGG - Intergenic
1110656568 13:78006926-78006948 GTAAAACAAAAAGTGGAGAAAGG - Intergenic
1111489209 13:88948346-88948368 TTGGAACATATGCTGGAGAAAGG + Intergenic
1111899251 13:94181034-94181056 CTGGAACAAAACCTGCAGTTTGG + Intronic
1115054433 14:29105578-29105600 CTGGAATAATAAGGGGAGAAGGG - Intergenic
1115299828 14:31871814-31871836 CTGGAAGAAAAAAAGGTGAATGG + Intergenic
1115311240 14:31980490-31980512 CTATACCAAAAAATGGAGAAGGG - Intergenic
1115414263 14:33112926-33112948 CAAAAACAAAAACTGGGGAAAGG - Intronic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1115905648 14:38200010-38200032 ATGTACCAAAAACTGGTGAATGG + Intergenic
1116043117 14:39710046-39710068 CTGGAGTTAAAAATGGAGAAAGG - Intergenic
1116128740 14:40825507-40825529 CTCCATCAAAAACTGGGGAAAGG + Intergenic
1116930582 14:50687367-50687389 CAGGAACCAATCCTGGAGAAGGG - Intergenic
1117007973 14:51441588-51441610 CAGGAACTAAAACTGGACCAAGG - Intergenic
1117173398 14:53123761-53123783 CTGGATTAAAAACCGGAGAATGG + Intronic
1117481677 14:56152040-56152062 CTGGAACACAGACTGGAGACAGG - Intronic
1117900750 14:60530299-60530321 CTGAAACACAATCTGGGGAAGGG - Intergenic
1118406893 14:65433376-65433398 CAGGAAGACAAACTGAAGAAAGG + Intronic
1120089534 14:80315046-80315068 CTGGAACACATTCTAGAGAAAGG - Intronic
1120957746 14:90097777-90097799 CTGGAAGAAAAACAAGACAATGG + Intronic
1120967403 14:90179928-90179950 CTGGTACCAAAACCGGAGAGGGG - Intronic
1121027890 14:90629901-90629923 TTGGAAAAAAAACTAGAAAAGGG + Intronic
1121167871 14:91824813-91824835 CTGGAACATAAACACAAGAAAGG + Intronic
1122869128 14:104626964-104626986 TTGGAGAAATAACTGGAGAAGGG + Intergenic
1124080988 15:26496220-26496242 CAAGAACATACACTGGAGAAAGG - Intergenic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124828715 15:33126731-33126753 CTGGAGCAGAAACTCGGGAAAGG + Intronic
1124855343 15:33382151-33382173 CTGGAAGGAAAACTGGATATGGG + Intronic
1124996404 15:34727252-34727274 ATGGAACAAAAAGATGAGAAAGG - Intergenic
1125094851 15:35839225-35839247 GGGGAAGAAAAACTAGAGAATGG - Intergenic
1125111759 15:36042228-36042250 CTGGCACAAAAACTTGTCAAAGG + Intergenic
1125384140 15:39118710-39118732 CTGGTACAAACACTGCTGAAAGG + Intergenic
1125711306 15:41789069-41789091 CTGGAACAAAAAGGGGAGTGTGG - Intronic
1125957082 15:43797912-43797934 CTGGAACAAGAACTGGTAAGGGG - Exonic
1126538569 15:49796243-49796265 CTGGAACAAAAACTGGAGAAAGG - Intergenic
1127095951 15:55512451-55512473 CTGGGACAGAAACTGTATAATGG - Intergenic
1127338943 15:58021059-58021081 ATGAGACAAATACTGGAGAAAGG - Intronic
1127494868 15:59500793-59500815 CTGGAACAAAAAATTGATAGAGG - Intronic
1129543007 15:76366612-76366634 TAGGAAAAGAAACTGGAGAATGG - Intronic
1129963100 15:79706981-79707003 CTAGAACATACACTGGGGAAAGG - Intergenic
1130769219 15:86907428-86907450 CTAGAACAAAATCTGGAAATGGG - Intronic
1130786985 15:87109489-87109511 CAGGAACATACATTGGAGAAAGG + Intergenic
1132195015 15:99908186-99908208 ATGGAAAAAAAACTGGCAAAAGG - Intergenic
1133574185 16:7072076-7072098 AAGGAACAAAGACTAGAGAACGG - Intronic
1134326219 16:13210261-13210283 CTAGAGGAAAAACTGGACAAGGG - Intronic
1134345765 16:13389932-13389954 GTGGAAAAAAGAATGGAGAATGG - Intergenic
1134423244 16:14113743-14113765 CTCTAACAAAAATTAGAGAAGGG + Intronic
1135802021 16:25506404-25506426 TTGGAATAAAAACTGAAGATAGG + Intergenic
1136108462 16:28048971-28048993 CTGGAGAAAAAAAGGGAGAAGGG + Intronic
1137653020 16:50136544-50136566 CTGGAGAAATAACTGCAGAATGG + Intergenic
1138524195 16:57592511-57592533 CTGGAAGGAAAACGGGGGAAGGG + Intergenic
1138914284 16:61444079-61444101 CTGGAACAAAAAAAGGAAATTGG + Intergenic
1139290538 16:65854294-65854316 GTGGAACAAAAATTGGCCAAGGG + Intergenic
1139667009 16:68464341-68464363 CTGGGACAAGAACTGGACAAAGG - Intergenic
1139745727 16:69072987-69073009 TTGTAACAAACACTGGAGGATGG + Intronic
1141285744 16:82669983-82670005 CAGGAATAAAAACTGCATAATGG - Intronic
1142732299 17:1868165-1868187 CTTTAACAGACACTGGAGAAAGG - Intronic
1145836903 17:27961245-27961267 CTGGGAAGAAAAATGGAGAAAGG - Intergenic
1146097487 17:29945719-29945741 CAGAAACATAAACTGGGGAAAGG + Intronic
1146476588 17:33167506-33167528 GAGACACAAAAACTGGAGAAGGG - Intronic
1147153842 17:38533432-38533454 CTGGAACAAAAACAGGGGTCAGG + Intronic
1148287744 17:46410703-46410725 CTGGAGCAAAGGCTGGAGCATGG - Intergenic
1148309913 17:46628283-46628305 CTGGAGCAAAGGCTGGAGCATGG - Intronic
1148709210 17:49664852-49664874 CTGGAACCAAAACAGTAGCAGGG - Intronic
1149033919 17:52113959-52113981 CTGTAGCAAAAACAGGAGGATGG + Intronic
1149631642 17:58130263-58130285 ATGGGATAAACACTGGAGAAGGG + Intergenic
1150239519 17:63621159-63621181 CTGGAACAGAGGCCGGAGAAAGG + Intergenic
1150941999 17:69702952-69702974 ATAGAATAAAAAGTGGAGAAAGG - Intergenic
1151092503 17:71458839-71458861 CTGAAACAAATACGGCAGAAAGG - Intergenic
1152105193 17:78324612-78324634 CTGGAACTGAAAAAGGAGAAGGG - Intergenic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153417561 18:4865239-4865261 ATGGTTCAAAAACTGGATAATGG - Intergenic
1153563094 18:6392219-6392241 CAGCAACATAAATTGGAGAAAGG + Intronic
1154488575 18:14900653-14900675 CTGTAACAAAGACTGGGAAATGG - Intergenic
1155195814 18:23472875-23472897 CTGAAACAGAAACAGGACAATGG - Intronic
1155403067 18:25459787-25459809 CTAGACCAAAACCTAGAGAAAGG - Intergenic
1155712168 18:28896045-28896067 CAAGAACACACACTGGAGAAAGG + Intergenic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1157206534 18:45705051-45705073 CAGAAACAAGAAATGGAGAAAGG + Intergenic
1158292415 18:55956534-55956556 CTGGGACAGAAACTGTATAATGG + Intergenic
1158300493 18:56046807-56046829 CTGGAAAAAAAAGTGGTGAGAGG - Intergenic
1159136624 18:64344251-64344273 CTGGAGCAGAAATTGGCGAAGGG + Intergenic
1159153225 18:64547480-64547502 CTAGAACATATACTGGGGAAAGG - Intergenic
1159611821 18:70534043-70534065 CTGGGATGACAACTGGAGAAAGG - Intergenic
1160326519 18:77954462-77954484 CTGGAATAAAAACTCTAGGATGG + Intergenic
1161025661 19:2035554-2035576 CTGCAACAAAAACTTAATAATGG + Intergenic
1161628977 19:5341929-5341951 CTAGAATAAAAACGGGATAATGG - Intergenic
1164123435 19:22288412-22288434 CAGGAAAAAAATCTGAAGAATGG - Intronic
1166993909 19:46710195-46710217 CTGGCTCAAAAACAGGAAAAAGG - Intronic
1167281492 19:48571856-48571878 TTGGAACAAAGACTTGAAAAAGG + Intronic
1167581736 19:50348447-50348469 CTTGGACAAAAACTGTATAATGG - Intronic
1167662474 19:50804086-50804108 CTAGAACAAAGACTGGGGGACGG - Intronic
1167753484 19:51395002-51395024 CTGGACCTAAAAGAGGAGAAAGG - Intergenic
925323383 2:2995448-2995470 GTAGAACAAAAACTGGAGAAAGG - Intergenic
925678842 2:6395608-6395630 CTTGAGTAAAAACTGGACAAGGG - Intergenic
926638538 2:15209855-15209877 CAAGAACAAACATTGGAGAAAGG + Intronic
926954621 2:18280949-18280971 CTGGACCAAAAAAGGGAGAAAGG + Intronic
927330707 2:21860087-21860109 CTGGAACAAGAGCAGAAGAAAGG + Intergenic
928932894 2:36643582-36643604 CAAGAACATACACTGGAGAAAGG + Intronic
929111353 2:38407662-38407684 GAGGAAAAAAAACAGGAGAAAGG - Intergenic
930062317 2:47300473-47300495 CTGGAACAGAGACTGGAATATGG - Intergenic
930570578 2:53080934-53080956 CAAGAACAAACACTGGGGAAAGG + Intergenic
931587695 2:63846128-63846150 CTGGAACAATCCCTGGAGCAAGG - Intronic
932211596 2:69936021-69936043 CTGGAAGAAGGGCTGGAGAAAGG - Intronic
933422571 2:82069151-82069173 ATTGAATAAAAACTGGATAAAGG - Intergenic
933849534 2:86354781-86354803 CTGGAATAGAAACTGCACAAGGG + Intergenic
934778072 2:96951379-96951401 CTGGAACAGCCACTGGAGCAGGG + Exonic
935304937 2:101728270-101728292 CTGGACCAAAAACTGTGGGATGG - Intronic
935351445 2:102154677-102154699 GTGGAACATAAACTGGAGACAGG - Intronic
935418307 2:102841511-102841533 CTTGAACCAAAACTGCAGACAGG + Intronic
936246988 2:110837012-110837034 CTTCAACAAAAGCTGGATAATGG - Intronic
936791027 2:116152130-116152152 CAAGAACACAAAATGGAGAAAGG - Intergenic
938341696 2:130540335-130540357 CTGGATCAAAATCTCGAGCACGG + Intronic
938348133 2:130580374-130580396 CTGGATCAAAATCTCGAGCACGG - Intronic
938512157 2:131961330-131961352 TAGTTACAAAAACTGGAGAATGG + Intergenic
938728648 2:134129223-134129245 CTGGCATTGAAACTGGAGAAGGG - Intronic
938988947 2:136608294-136608316 CAGGAACAAAAACCAGAGATGGG + Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939537120 2:143445554-143445576 GATGAAAAAAAACTGGAGAAGGG - Intronic
939774380 2:146366217-146366239 ATGGAACAAAAAGTGAAGGAAGG + Intergenic
939919500 2:148091539-148091561 CAGAAACATAAAGTGGAGAAAGG + Intronic
941028931 2:160490821-160490843 CTATATCAAAAACTGAAGAATGG - Intronic
941866571 2:170341257-170341279 TTGAAACACAAAATGGAGAAAGG - Intronic
942796641 2:179828516-179828538 CTGAAACAAAAAGTGAATAAAGG - Intronic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
944984636 2:205161535-205161557 CTGGAACAACAGTAGGAGAATGG - Intronic
945031447 2:205667800-205667822 CAAGAACATAAACTGGGGAAAGG - Intergenic
945359295 2:208877601-208877623 CCAGAACAAACACTGGGGAAAGG - Intergenic
946219174 2:218211631-218211653 CTGGAGGACTAACTGGAGAATGG + Intergenic
946906654 2:224423525-224423547 CAAGAACAAACACTGGGGAAAGG + Intergenic
946975307 2:225141851-225141873 CTGGAATAAATACTGGATACTGG - Intergenic
948655383 2:239473645-239473667 CTGGAACTGAACCTGGAGCATGG + Intergenic
1169992643 20:11520509-11520531 CAGAAACAAAAAGAGGAGAAAGG + Intergenic
1170379911 20:15747055-15747077 ATGGACCATAAACAGGAGAATGG + Intronic
1170423548 20:16216047-16216069 CTAGAAGAAAAACTGGTGATGGG + Intergenic
1170726630 20:18933940-18933962 CTAATACAAAAACTGGGGAAGGG - Intergenic
1170956966 20:20990329-20990351 CTAGAACCAAAAATGGAGAAAGG - Intergenic
1171204292 20:23267004-23267026 TTGGAAGAAGAACTGGTGAAAGG + Intergenic
1171960001 20:31486488-31486510 GTGGAAGAAATACTTGAGAACGG + Intergenic
1173386103 20:42589399-42589421 CTGGCACACAAATTGAAGAACGG - Intronic
1173632543 20:44527510-44527532 TTGGAATAAAGACTGGAGCAGGG + Intergenic
1174000256 20:47369334-47369356 CCTGAGCAAAAGCTGGAGAAGGG - Intergenic
1175097194 20:56550840-56550862 CTGAAGCAAAATCTGGAAAAAGG - Intergenic
1175521420 20:59604722-59604744 CTGGAATATAGACTGAAGAATGG + Exonic
1175554885 20:59843566-59843588 CAAGAACATAAACTGGGGAAAGG + Intronic
1175688521 20:61048814-61048836 CTGGAACTGAAACCAGAGAAAGG + Intergenic
1175778352 20:61666918-61666940 CTTGAGCAAAGCCTGGAGAAGGG + Intronic
1175778871 20:61669561-61669583 ATGGAAGGAAAACTGAAGAAGGG + Intronic
1176668884 21:9713498-9713520 CTGAGACAAAAACTTGAGACAGG + Intergenic
1177305066 21:19304762-19304784 CTGTAATAAAAGCTGGGGAAAGG + Intergenic
1177568306 21:22852456-22852478 ATGGAACAAAAACTGGAGAAAGG - Intergenic
1177618160 21:23552713-23552735 GAGGAATAAAAACTGGAGAAAGG - Intergenic
1177774009 21:25548093-25548115 ATAGAACAAAAAGTGGAGGAAGG - Intergenic
1178448041 21:32663316-32663338 CTGGGACAGAAACTGTATAATGG + Intronic
1179669365 21:42935337-42935359 CTTGGACAAAAACTGTATAATGG + Intergenic
1180201395 21:46226749-46226771 CTGGGACAAAATCAGGATAAAGG + Intronic
1183799689 22:40151622-40151644 ATGGAACAAGAACAGGAGACTGG + Intronic
1184177708 22:42798791-42798813 CTAGGAAAAAAACTGGACAATGG + Intronic
1184539495 22:45110961-45110983 CTGGAACATAAAATGTAGAGGGG - Intergenic
1184820688 22:46907511-46907533 ATGGCACAAAACCTGGAGAAGGG + Intronic
1185178375 22:49344831-49344853 CTGGAACAGAAGCGGGAGGAGGG + Intergenic
949472640 3:4412909-4412931 ATGAAACAAACACTGGAGGAAGG + Intronic
950219954 3:11186967-11186989 CTGGAATTAATTCTGGAGAAAGG - Intronic
950672269 3:14534400-14534422 CTGGAACAAAAAAGAGAGAGTGG - Intronic
951136963 3:19115269-19115291 ATACAACAAATACTGGAGAAGGG + Intergenic
951334441 3:21404749-21404771 CAAGAACATACACTGGAGAAAGG + Intergenic
952040193 3:29252194-29252216 CTGCACCAAAAACTGGAGAGAGG + Intergenic
953382603 3:42485156-42485178 ATGAAACATAAAGTGGAGAAAGG + Intergenic
953630628 3:44613506-44613528 CAGGAACACACATTGGAGAAAGG + Intronic
953635729 3:44662345-44662367 TTGGAAAAAAAACTAGAGGAGGG - Intergenic
954836064 3:53469221-53469243 CAGAAACAAGAAATGGAGAAAGG - Intergenic
955599042 3:60624594-60624616 CAAGAAGAAAAACTGGATAAAGG + Intronic
955608808 3:60735329-60735351 CTGGAGTCAGAACTGGAGAAGGG - Intronic
956390086 3:68762522-68762544 CTGTATCAAAAACTGGGGAGAGG - Intronic
956779817 3:72595086-72595108 ATGGACTAAAAACAGGAGAATGG + Intergenic
957364034 3:79198297-79198319 CAAAAACAAAAAATGGAGAAAGG - Intronic
957406540 3:79779547-79779569 CTGGGACAGAAACTGTATAATGG + Intergenic
957999591 3:87734998-87735020 CTGGGACAAAAACTGTATAATGG - Intergenic
958685931 3:97394149-97394171 CAAGAACAAAAACTGGAGAAAGG + Intronic
958881837 3:99680870-99680892 CAGAAACAAGAAATGGAGAAAGG + Intronic
959349652 3:105245836-105245858 CTGGAAAAAAAAGTGAACAAAGG + Intergenic
959427053 3:106204115-106204137 GTAGAACAAAAAATGGAGCAAGG - Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959961128 3:112299845-112299867 ATAGAAAAAAAACTAGAGAAGGG - Intergenic
960130854 3:114054664-114054686 CAACAACAAAAACTGGGGAATGG + Intronic
961398760 3:126618451-126618473 CAAGAACATACACTGGAGAAAGG + Intronic
962584097 3:136823980-136824002 CAGGAACATACACTGGAGAAAGG - Intronic
962725894 3:138226444-138226466 CTGGATCATAAACTGGAGGTGGG - Intronic
963411701 3:144936568-144936590 CAAGAACATACACTGGAGAAAGG + Intergenic
963531943 3:146481958-146481980 CAAGAACAAAAAATGAAGAAAGG + Intronic
964146872 3:153474211-153474233 CAGAAACAAAAAGTGGGGAAAGG - Intergenic
964240582 3:154588824-154588846 CTATAAAAAAAACTGGAGAAAGG + Intergenic
964467236 3:157007747-157007769 CTGGTACAAAATGTGGAGCAAGG + Intronic
964522074 3:157580647-157580669 CTGGGACAGAAACTGTATAATGG - Intronic
964582081 3:158251080-158251102 CATGAACATAGACTGGAGAAAGG - Intronic
964832513 3:160900755-160900777 CTCAAACAAAAACTCAAGAAAGG - Intronic
964924340 3:161937663-161937685 CTGGGACAGAAACTGTATAATGG + Intergenic
965076007 3:163977309-163977331 CTGGAATAAAAGAAGGAGAAGGG - Intergenic
965251184 3:166346573-166346595 CTGAAACCAAAACTAGACAAAGG + Intergenic
965400392 3:168206264-168206286 ATAGAACAAAAGCTGGAGCAGGG - Intergenic
966314370 3:178629161-178629183 CTGGAACTAAAAATGCAGGAAGG - Intronic
966383517 3:179368574-179368596 TTGGCACAAAATATGGAGAATGG - Intronic
968181906 3:196601662-196601684 CTGGAACCCTAACTGGGGAAAGG - Intergenic
968334689 3:197903060-197903082 CAAGAACAAACACTGGGGAAAGG + Intronic
968547039 4:1204596-1204618 CTGGAACAAAAGATGAACAAGGG - Intronic
969166733 4:5322582-5322604 CAGGAAGAAGAAGTGGAGAAAGG + Intronic
970110316 4:12630369-12630391 CTAGAAAAAAACCTAGAGAAAGG + Intergenic
970190602 4:13512572-13512594 CTGGAAGAAAAGGTGCAGAAAGG - Intergenic
970641584 4:18072196-18072218 CTGGAACAAAAAAAGGACATTGG + Intergenic
970821392 4:20219422-20219444 CTAGAACATACACTGGGGAAAGG - Intergenic
970985606 4:22153373-22153395 CAAGAACATACACTGGAGAAAGG + Intergenic
971808064 4:31386346-31386368 CTTGAACAATAACTGAAAAAAGG + Intergenic
971838786 4:31804255-31804277 TTGGGACAAAAAGTGGAGATGGG + Intergenic
971963397 4:33518636-33518658 CTGGAAGCTAATCTGGAGAAAGG - Intergenic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
975222668 4:71831751-71831773 CTGAAACAAAGAAAGGAGAAAGG - Intergenic
976574137 4:86649486-86649508 CAGGAACATATATTGGAGAAAGG - Intronic
976649955 4:87423530-87423552 AAAGAATAAAAACTGGAGAAGGG - Intronic
976969707 4:91090461-91090483 CTTGGACAAAAACTGTATAATGG - Intronic
977009082 4:91613001-91613023 ATGGAGCAAAAAATGGACAATGG + Intergenic
977434957 4:96982550-96982572 CTCTAACAAAAACTGGGCAAAGG + Intergenic
977563812 4:98561437-98561459 CTGGCACAAATCCTGGAAAATGG + Intronic
979532059 4:121779510-121779532 CAGAAACAATAGCTGGAGAATGG - Intergenic
979582472 4:122377054-122377076 CTGGAACAGAAAATGGACATTGG + Intergenic
979641351 4:123015632-123015654 GTGGAACAGAAAGGGGAGAAAGG - Intronic
980769132 4:137349302-137349324 CAAGAACATACACTGGAGAAAGG + Intergenic
980780475 4:137485597-137485619 CTGGGACAGAAACTGTATAATGG + Intergenic
981334290 4:143551655-143551677 CAAGAACATACACTGGAGAAAGG - Intronic
984338907 4:178428601-178428623 CAGGAACATACACTGGGGAAAGG + Intergenic
984518904 4:180776498-180776520 CAAGAACAAAAAATGGGGAAAGG - Intergenic
985405899 4:189638015-189638037 CTGAGACAAAAACTTGAGACAGG - Intergenic
987842796 5:23242346-23242368 TTGGAACAAAAACAGGAAATTGG + Intergenic
987968985 5:24917493-24917515 CTGCAAAAAAAACTGCAAAATGG - Intergenic
989283722 5:39674845-39674867 CTGGAGCAGATACTGGAGAAAGG + Intergenic
989515959 5:42343578-42343600 CTAGAACATACATTGGAGAAAGG + Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
990742430 5:58925702-58925724 CTGGCTCAAACACTTGAGAATGG - Intergenic
991106329 5:62846900-62846922 CAGGAACATACACTGGGGAAAGG - Intergenic
991317284 5:65323044-65323066 CTGATACCAAAACTGGACAAAGG + Intronic
991675849 5:69089264-69089286 CTGGGACAGAAACTGTATAATGG - Intergenic
992228185 5:74639509-74639531 CAGGTTCAAAACCTGGAGAAGGG - Intronic
992659756 5:78947010-78947032 CAAGAACAGACACTGGAGAAAGG + Intronic
993126054 5:83836882-83836904 CTGGAAGAAAAAGTGGGGGAAGG - Intergenic
993954485 5:94215683-94215705 CTGGGACTTAAACTGGTGAATGG + Intronic
994590941 5:101770748-101770770 CTGAAACAAAACCTTGAAAATGG - Intergenic
995472240 5:112515095-112515117 ATGGGAAAAAAACTGGACAAAGG - Intergenic
995474150 5:112531202-112531224 CTGGAACAGAAACTGTATAATGG + Intergenic
996374408 5:122789359-122789381 CCAGAGAAAAAACTGGAGAAGGG - Intronic
996876746 5:128249068-128249090 CTGGAGCACATGCTGGAGAAAGG - Intergenic
996984288 5:129539871-129539893 CTGGAAACAAATATGGAGAAAGG - Intronic
997695695 5:135858943-135858965 CAGGATCAACTACTGGAGAAGGG + Intronic
999156700 5:149463372-149463394 CAAGAACAAACACTGGGGAAGGG - Intergenic
999958873 5:156732632-156732654 CTGTGACAAAAAATTGAGAAGGG - Intronic
1000168504 5:158678590-158678612 CAGGAACAAGAACTGAAGAATGG - Intergenic
1000181571 5:158816791-158816813 CTGAAAAAAAAAGAGGAGAAAGG + Intronic
1000442836 5:161283480-161283502 CTGGAACAAGAACTGTAGCCAGG + Intergenic
1000610680 5:163370721-163370743 CTGTAACAAAAATTGTAAAAGGG + Intergenic
1001847580 5:174935715-174935737 ATGGAACCAAAACTGGAGTGGGG - Intergenic
1002407827 5:179049977-179049999 CTTGGACAAAAACTGTATAATGG - Intergenic
1003383198 6:5643837-5643859 CTAGAAGAAAAACTCGAGGAGGG + Intronic
1003603554 6:7540857-7540879 CTGGTACAAAATTTGGAAAATGG + Intergenic
1004213121 6:13672874-13672896 CTTGAAAAAAAACTGGAACATGG + Intronic
1004310964 6:14544525-14544547 CTGGAACAAAACCCAGTGAAGGG + Intergenic
1004933381 6:20483758-20483780 TTGGAACTAAAACTAGAGATGGG - Intronic
1005127887 6:22469921-22469943 CTGAGACAAAGACTGGAGCAGGG - Intergenic
1007057392 6:38901043-38901065 ATTGAAAAAAAAATGGAGAAAGG - Intronic
1007851891 6:44811107-44811129 CTGGAGCAGAAACGGGACAATGG - Intronic
1007908720 6:45490865-45490887 CTGGCACAGAATCTGGAGGAAGG + Intronic
1007998609 6:46335225-46335247 CAGAAAGAAAAAGTGGAGAAAGG + Intronic
1008820033 6:55620882-55620904 CAAGAACAAACATTGGAGAAAGG - Intergenic
1008872772 6:56291354-56291376 CTGGAAAAAAAACTGCAAACTGG + Intronic
1009380738 6:63025632-63025654 CTGGAAAAAAAACTAGAGGAGGG + Intergenic
1009814469 6:68713600-68713622 CTGGAAAAATAACATGAGAAAGG - Intronic
1010102561 6:72126154-72126176 CAAGAACAAAAATTGGAGAAAGG + Intronic
1010730307 6:79383579-79383601 CCTGAACAACCACTGGAGAAGGG + Intergenic
1010976299 6:82317993-82318015 CAGAAACATAAAGTGGAGAAAGG + Intergenic
1011292489 6:85791171-85791193 CTAGAACAAAATGTGGAGGAAGG + Intergenic
1013168175 6:107612541-107612563 CTGAACCAGAAACTGGAGAGTGG + Intronic
1013381033 6:109570771-109570793 CTGAAGCAATAACTGAAGAAAGG + Intronic
1013960311 6:115890805-115890827 GTGGAACAAAAGCAGAAGAAAGG + Intergenic
1014353397 6:120372888-120372910 CTGGACCAAAAACTGGTACAGGG - Intergenic
1014546568 6:122742937-122742959 CTGGGACAGAAACTGTATAATGG - Intergenic
1015060929 6:128964559-128964581 CTGGAACAAATATTAAAGAATGG + Intronic
1015595215 6:134859920-134859942 CTGCATCTAACACTGGAGAAGGG + Intergenic
1015668242 6:135656396-135656418 CTAGAAAAAACACTGGGGAAAGG - Intergenic
1015816860 6:137219607-137219629 CTGGAAGAAGAATTGCAGAATGG - Intergenic
1015819109 6:137241216-137241238 CTTTATCAAAAACTGGATAATGG + Intergenic
1015937283 6:138416327-138416349 CTGGGACAAACAATAGAGAAAGG + Exonic
1016216488 6:141609780-141609802 CTGGAACAAAAAAAGGACATTGG - Intergenic
1017641315 6:156496936-156496958 CTAGAAAAAAAACTGGAGGAGGG + Intergenic
1018079662 6:160247886-160247908 CGGGAGGAGAAACTGGAGAAAGG + Intronic
1018235441 6:161719072-161719094 CTTGAAGAAAAACTAGAAAATGG + Intronic
1018825200 6:167403671-167403693 CAGGGACAAAAACTGGAAAGTGG - Intergenic
1019191328 6:170252673-170252695 ATGGAGCAAAGGCTGGAGAAAGG - Intergenic
1019534270 7:1520375-1520397 CTGGAACAGAAGGTGGAGGAAGG + Intergenic
1020361911 7:7335837-7335859 CTGTAACAAATACTACAGAATGG - Intergenic
1020744239 7:12061486-12061508 CAAGAACAGAAAATGGAGAAAGG + Intergenic
1021001405 7:15335792-15335814 CTGAAACCACAACTGAAGAAAGG - Intronic
1021046523 7:15929437-15929459 CAAGAACATAAATTGGAGAAAGG + Intergenic
1021477131 7:21074722-21074744 ATAGAACTAAAACTGGACAATGG + Intergenic
1021909837 7:25374196-25374218 CTGAAACCAAAACTAGACAAAGG - Intergenic
1022054337 7:26713931-26713953 CAAGAAAACAAACTGGAGAAGGG + Intronic
1023359910 7:39405356-39405378 CTGAGACAAAAAATGAAGAAAGG + Intronic
1023659223 7:42455946-42455968 GAGGAACCATAACTGGAGAATGG + Intergenic
1023833686 7:44056174-44056196 CAGGAACATACACTGGGGAAAGG - Intronic
1024877321 7:54040880-54040902 CTTGAATAAAAACTGGGTAAAGG - Intergenic
1024912548 7:54462570-54462592 TAGAAACAAAAATTGGAGAATGG + Intergenic
1025161983 7:56669215-56669237 CTGGAACACAGCTTGGAGAAGGG - Intergenic
1027056253 7:75051910-75051932 CTGGAACAAAAACTGGGTGGTGG + Intronic
1027497542 7:78906995-78907017 CTCAAACAAAAACTAGACAATGG + Intronic
1027618837 7:80457596-80457618 CTGGAATAAAATGTGGGGAATGG + Intronic
1027628347 7:80571819-80571841 CAGGAACATACACTGGGGAAAGG - Intronic
1028284282 7:88976029-88976051 CAAGAACATACACTGGAGAAAGG - Intronic
1028509654 7:91610216-91610238 CTAGATCAAATGCTGGAGAAAGG - Intergenic
1028578029 7:92374734-92374756 CTTGAAGAAAACCAGGAGAAAGG + Intronic
1030056992 7:105591826-105591848 TTGAAACAAAAAATGGAGAGAGG - Intronic
1030314225 7:108097870-108097892 CTGGAACAAACACGGGGAAATGG - Intronic
1030658604 7:112195293-112195315 CTAGCAAACAAACTGGAGAAGGG + Intronic
1031368354 7:120932183-120932205 CTGAAACAAAAGCTGGAGTTAGG + Intergenic
1031412839 7:121460222-121460244 AAGGAACACAAACTGGTGAAGGG - Intergenic
1033389508 7:140913060-140913082 TTTGAACAAAAATTTGAGAAAGG - Intronic
1034786871 7:153934332-153934354 ATGGAAAAAAAAAAGGAGAAGGG - Intronic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1035617529 8:1013120-1013142 CTAGATCAAAAACTGGAACAGGG - Intergenic
1035619521 8:1027332-1027354 CTGGTACCACACCTGGAGAATGG - Intergenic
1037138736 8:15494787-15494809 CTGCAACAAAAACTGGAATTAGG + Intronic
1038853625 8:31306373-31306395 CAGGAACACACAATGGAGAAAGG - Intergenic
1040752180 8:50723785-50723807 ATGGAAAAAAAAAAGGAGAAAGG + Intronic
1041325925 8:56664366-56664388 CAAGAACATACACTGGAGAAAGG - Intergenic
1041334092 8:56760356-56760378 CTGGAACTAAACTTGGATAAAGG - Intergenic
1041610627 8:59843322-59843344 CAAGAACATACACTGGAGAAAGG + Intergenic
1041829559 8:62138522-62138544 CTTGAACAAAAACTTAATAAGGG - Intergenic
1043349272 8:79340745-79340767 CTGGTACAAAAAGGGCAGAAGGG + Intergenic
1043355181 8:79403328-79403350 CTGGAATAAAAGCTGCAGAATGG - Intergenic
1044114507 8:88318398-88318420 CTGGACTAAAAACTGAATAAGGG - Intronic
1045102325 8:98857902-98857924 TTAGAAGCAAAACTGGAGAAAGG + Intronic
1045579106 8:103459101-103459123 CAGAAAGAAAGACTGGAGAAAGG - Intergenic
1045813342 8:106250481-106250503 ATAGAACAAAAAGTGGAGGAAGG - Intergenic
1046057733 8:109098455-109098477 CTGGAAGAAGAACTGGAGGAGGG - Intronic
1046274934 8:111946325-111946347 CAGAAACAGCAACTGGAGAAGGG + Intergenic
1046463000 8:114567660-114567682 CAAGAACATATACTGGAGAAAGG - Intergenic
1047809264 8:128390710-128390732 CTCTAACAAAACCTGTAGAAAGG - Intergenic
1047863220 8:128991777-128991799 GTGAAAATAAAACTGGAGAAGGG - Intergenic
1048709972 8:137199075-137199097 GTAGAACAAAAAGTGGAGGAAGG - Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050643830 9:7697012-7697034 CAGTAACAAACACTGGAGAGAGG - Intergenic
1050678216 9:8080284-8080306 CTCCATCAAAAACTGGACAAAGG - Intergenic
1052071368 9:24085528-24085550 CTGGCACAAAAACAGAAAAATGG - Intergenic
1052275693 9:26673723-26673745 CTTGAAAAGCAACTGGAGAAGGG - Intergenic
1052636799 9:31116822-31116844 CAACAACAAAAACTGGAGACGGG - Intergenic
1055117870 9:72624931-72624953 AAGGTACAAAAACAGGAGAATGG + Intronic
1058021004 9:100088624-100088646 ATGAAACAAAAAGTGGTGAAAGG - Intronic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1058092630 9:100822864-100822886 CTGTAACAATAAATGGAGAATGG - Intergenic
1058407060 9:104688644-104688666 TTGGAAAGAAAATTGGAGAAAGG - Intergenic
1060217771 9:121748785-121748807 CTGCAACCAAAACAGGAGGATGG - Intronic
1061412561 9:130429434-130429456 GTGGCACTGAAACTGGAGAAGGG + Intronic
1203656982 Un_KI270753v1:7437-7459 CTGAGACAAAAACTTGAGACAGG - Intergenic
1185910293 X:3974741-3974763 CTGGGACAGAAACTGTATAATGG + Intergenic
1188314554 X:28657329-28657351 CTGGAAAAAAATGTGGAAAATGG - Intronic
1188426647 X:30055321-30055343 CAGGAACATACACTGGGGAAAGG - Intergenic
1188775585 X:34214658-34214680 CTGAAACAAACAATGGAGAGAGG + Intergenic
1188865432 X:35307556-35307578 CAAGAACATAAATTGGAGAAAGG + Intergenic
1189247808 X:39576942-39576964 CTGGAACTACAACGGGAGACTGG - Intergenic
1189580585 X:42402203-42402225 CTGGAAAACAAACTGTAAAATGG + Intergenic
1189951108 X:46231946-46231968 CAGGAACAAACATTGCAGAAAGG + Intergenic
1190425507 X:50331410-50331432 CTGGGACAGAAACTGTATAATGG - Intronic
1191240372 X:58185291-58185313 CTGGAATAAAAACTAGAAACAGG + Intergenic
1191708650 X:64122317-64122339 CAAGAACATAAACTGGGGAAAGG - Intergenic
1192000082 X:67140509-67140531 CTGGACCCAACAATGGAGAATGG - Intergenic
1192343992 X:70286269-70286291 CTGGAACATAAACTAAGGAAGGG - Intergenic
1192500424 X:71646546-71646568 CAAGAACATAAACTGGGGAAAGG - Intergenic
1192815852 X:74591275-74591297 CTGGAACAAAAACTGGAGAAAGG + Exonic
1193888546 X:87013814-87013836 CTGAAACAAAAACCAGAGAAAGG + Intergenic
1193961440 X:87929865-87929887 CAGAAACAAAAACTGGCTAATGG + Intergenic
1193964280 X:87965468-87965490 CTGAAACATAAATTGGAAAAAGG + Intergenic
1194331753 X:92591570-92591592 CTGGAGCAAAAACTAGATAAAGG + Intronic
1194384708 X:93238207-93238229 CTGGGACAGAAACTGTATAATGG + Intergenic
1194650387 X:96507588-96507610 CAGCATCAAAAACTGCAGAATGG - Intergenic
1195095702 X:101499148-101499170 CTGGAATATAAACTGGAATATGG + Intronic
1195171793 X:102275933-102275955 CAAGAACATATACTGGAGAAAGG - Intergenic
1195187067 X:102411160-102411182 CAAGAACATATACTGGAGAAAGG + Intronic
1195617074 X:106920827-106920849 CTGGGATAAAAATTGGAGGAAGG + Intronic
1196207527 X:112957707-112957729 CTGGATCAGAGAGTGGAGAAAGG - Intergenic
1196622825 X:117842787-117842809 CAAGAACAAACAATGGAGAAAGG - Intergenic
1197326695 X:125103265-125103287 CTGGCACAAATACTGTAAAATGG + Intergenic
1197587123 X:128362502-128362524 CAAGAACATAAACTGGGGAAAGG - Intergenic
1198143132 X:133826030-133826052 CAGCAACAAACACTGGGGAAGGG + Intronic
1198956845 X:142142020-142142042 CAAGAACATAAACTGGGGAAAGG + Intergenic
1199906247 X:152234730-152234752 CGGAAACATACACTGGAGAAAGG - Intronic
1200640459 Y:5710629-5710651 CTGGAGCAAAAACTAGATAAAGG + Intronic