ID: 1192818053

View in Genome Browser
Species Human (GRCh38)
Location X:74614698-74614720
Sequence ATTCCTCGAAAAGGCTCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192818040_1192818053 22 Left 1192818040 X:74614653-74614675 CCGGCACCGCAGCCCCACTCCCA 0: 1
1: 1
2: 5
3: 77
4: 675
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818042_1192818053 10 Left 1192818042 X:74614665-74614687 CCCCACTCCCAGCCTATTAGCCA 0: 1
1: 0
2: 2
3: 16
4: 207
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818038_1192818053 29 Left 1192818038 X:74614646-74614668 CCGCGTCCCGGCACCGCAGCCCC 0: 1
1: 0
2: 3
3: 40
4: 449
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818048_1192818053 -10 Left 1192818048 X:74614685-74614707 CCAATCCCAGTCGATTCCTCGAA 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818045_1192818053 3 Left 1192818045 X:74614672-74614694 CCCAGCCTATTAGCCAATCCCAG 0: 1
1: 0
2: 1
3: 5
4: 91
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818039_1192818053 23 Left 1192818039 X:74614652-74614674 CCCGGCACCGCAGCCCCACTCCC 0: 1
1: 0
2: 0
3: 64
4: 589
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818041_1192818053 16 Left 1192818041 X:74614659-74614681 CCGCAGCCCCACTCCCAGCCTAT 0: 1
1: 0
2: 11
3: 94
4: 940
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818046_1192818053 2 Left 1192818046 X:74614673-74614695 CCAGCCTATTAGCCAATCCCAGT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818044_1192818053 8 Left 1192818044 X:74614667-74614689 CCACTCCCAGCCTATTAGCCAAT 0: 1
1: 0
2: 4
3: 28
4: 279
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818047_1192818053 -2 Left 1192818047 X:74614677-74614699 CCTATTAGCCAATCCCAGTCGAT 0: 1
1: 0
2: 0
3: 1
4: 42
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54
1192818043_1192818053 9 Left 1192818043 X:74614666-74614688 CCCACTCCCAGCCTATTAGCCAA 0: 1
1: 0
2: 0
3: 11
4: 145
Right 1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192818053 Original CRISPR ATTCCTCGAAAAGGCTCCGC GGG Intergenic
900168444 1:1254429-1254451 ATTCAGAGAAAAGGCTCTGCAGG + Intronic
907449662 1:54536882-54536904 ATTGCTCAAAATGGCTCCTCAGG - Intergenic
913132843 1:115857711-115857733 ATTGCTCAAAATGGCTCCTCAGG + Intergenic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
920068524 1:203286364-203286386 CTTCCTCTAAAAGGCTTCCCAGG + Intergenic
920261308 1:204689839-204689861 ATTCCTGGAAAAGGCACTGCAGG + Intergenic
922144738 1:222930129-222930151 ATTTCCCCAAAAGGCTCCACTGG - Intronic
1079360755 11:19768448-19768470 CATCCTTGAAAAGGCTCCTCAGG - Intronic
1082658727 11:55883961-55883983 ATTCCTTGAAATGGCTCAGATGG + Intronic
1085161788 11:74354529-74354551 ATTGCTCAAAATGGCTCCTCAGG - Intronic
1088303420 11:108383362-108383384 ATCCCTACAAAAGGCTCTGCAGG + Intronic
1090310863 11:125737348-125737370 AGTCCTTGAAAAGGCTCTCCTGG - Intergenic
1093950681 12:25162778-25162800 CTTCCTCTAAAAAGCTCAGCTGG + Intronic
1096818366 12:54215935-54215957 AACCCTAGAAAAGGCTCCTCTGG - Intergenic
1096826403 12:54281457-54281479 ATTGCTCAAAATGGCTCCTCAGG - Exonic
1098199085 12:68035853-68035875 ATTACTCAAAATGGCTCCTCAGG - Intergenic
1100255988 12:92883860-92883882 ATTGCTCAAAATGGCTCCTCAGG - Intronic
1101872416 12:108577067-108577089 ATAACTCCAAAAGGCTCCCCAGG + Intergenic
1107974732 13:45678451-45678473 ATTCCTTGAAAATGCTTCACAGG - Intergenic
1108666979 13:52642579-52642601 ATTGCTCAAAATGGCTCCTCAGG - Exonic
1114019970 14:18469364-18469386 ATTCCAGAAAAAGGCTCCGAGGG - Intergenic
1125754560 15:42054167-42054189 ACTCCTAGAATAGGCTCCACAGG + Intergenic
1128202085 15:65817404-65817426 ATTGCTCAAAATGGCTCCTCAGG + Intronic
1128815993 15:70608759-70608781 ATTCCTGGAAAAGGCACCTGGGG + Intergenic
1135776705 16:25262922-25262944 AGTCCCCGGAAAGGCTCCCCAGG + Intergenic
1137841595 16:51645904-51645926 ATTGCTCAAAATGGCTCCTCAGG - Intergenic
1139585866 16:67903079-67903101 ATTCCTCCACAAGGCTCTTCAGG - Intronic
1141050800 16:80761570-80761592 ATGTGTTGAAAAGGCTCCGCAGG - Intronic
1151287917 17:73126712-73126734 AGTCCTGGAACAGGCTCTGCTGG + Intergenic
1156003556 18:32413068-32413090 ATTGCTCAAAATGGCTCCTCAGG + Intronic
1162600790 19:11666922-11666944 ATTGCTCAAAATGGCTCCTCAGG + Intergenic
1166230644 19:41424355-41424377 ATTCCTTGCCAAGGCCCCGCAGG + Intronic
1167479353 19:49720015-49720037 ATTTCTCGAAGGGTCTCCGCGGG + Intergenic
1168112463 19:54201229-54201251 ATTTCTCGAAGGGTCTCCGCGGG - Exonic
939659113 2:144866070-144866092 ATTCCTCGAAATAGCTCCAGTGG - Intergenic
945117264 2:206420130-206420152 ATTGCTCAAAATGGCTCCTCAGG + Intergenic
1172210714 20:33196373-33196395 ATTCCTAGAAAATGCTTCGTGGG + Intergenic
1172698743 20:36839771-36839793 ATTCCTCGGGAAGGCTCCAGGGG - Intronic
1179561032 21:42216406-42216428 ATGCCTCGAAAAGTCTTGGCTGG + Intronic
1180444477 22:15400189-15400211 ATTCCAGAAAAAGGCTCCGAGGG - Intergenic
949914009 3:8942616-8942638 ATTCCTAGAAAATGCTCCCAGGG - Intronic
953050236 3:39335062-39335084 ATTGCTCAAAATGGCTCCTCAGG - Intergenic
953437407 3:42889447-42889469 ATTGCTCAAAATGGCTCCTCAGG - Intronic
956860798 3:73321811-73321833 ATTCCTCCAAAACACTCCACAGG - Intergenic
975794196 4:77988705-77988727 ATTGCTCAAAATGGCTCCTCAGG + Intergenic
994042253 5:95272546-95272568 ATTCCTGGCAAATGCTCAGCAGG + Intronic
1005610820 6:27523479-27523501 ATTGCTCAAAATGGCTCCTCAGG - Intergenic
1028164402 7:87521550-87521572 ATTGCTCAAAATGGCTCCTCAGG - Intronic
1028671116 7:93401094-93401116 ATTCCTCCAACAGGCTCTGAGGG + Intergenic
1039816744 8:41101024-41101046 GCTCTTGGAAAAGGCTCCGCAGG - Intergenic
1043589145 8:81807858-81807880 ATTGCTCAAAATGGCTCCTCAGG - Intronic
1050373395 9:4945796-4945818 ATTGCTCAAAATGGCTCCTCAGG + Intergenic
1054848845 9:69825562-69825584 ATTCCTAGAAAAGGCATCTCTGG - Intronic
1056645870 9:88411354-88411376 ATTGCTCAAAATGGCTCCTCAGG + Intronic
1060405919 9:123373082-123373104 ATTTCTGGAGAAGGCTCCGTGGG + Intronic
1192818053 X:74614698-74614720 ATTCCTCGAAAAGGCTCCGCGGG + Intergenic