ID: 1192830419

View in Genome Browser
Species Human (GRCh38)
Location X:74745281-74745303
Sequence GAGGCTTAGAACTTCTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192830419_1192830423 28 Left 1192830419 X:74745281-74745303 CCACTCTAGAAGTTCTAAGCCTC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1192830423 X:74745332-74745354 GAATTTTGAGGATCTTCATCTGG 0: 1
1: 0
2: 1
3: 17
4: 165
1192830419_1192830421 6 Left 1192830419 X:74745281-74745303 CCACTCTAGAAGTTCTAAGCCTC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1192830421 X:74745310-74745332 CAGCATATTTCTAATTCACTAGG 0: 1
1: 0
2: 0
3: 11
4: 222
1192830419_1192830422 16 Left 1192830419 X:74745281-74745303 CCACTCTAGAAGTTCTAAGCCTC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1192830422 X:74745320-74745342 CTAATTCACTAGGAATTTTGAGG 0: 1
1: 0
2: 3
3: 15
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192830419 Original CRISPR GAGGCTTAGAACTTCTAGAG TGG (reversed) Intronic
900725220 1:4212035-4212057 GAGGCTTAGAACTTCAGCACAGG - Intergenic
904042329 1:27592123-27592145 GAGGCTTATTACTTGTGGAGGGG - Intronic
907963204 1:59302665-59302687 GAGGGTTAGATCTACTTGAGGGG + Intronic
909575253 1:77168153-77168175 GAGGGATAGAAATTCTAGATTGG - Intronic
914981264 1:152416264-152416286 GGGGCTTAGAACTTCCAGAAAGG + Intergenic
919790468 1:201287169-201287191 GAGGCTTAGCAATTTTAGATGGG - Intronic
920306707 1:205022970-205022992 GAGAATAACAACTTCTAGAGGGG - Intergenic
920660330 1:207909741-207909763 GAGGTTTCAAAATTCTAGAGTGG - Intronic
1071940841 10:90589872-90589894 GAGGCTTAGAAATTCTGGCTTGG - Intergenic
1076472316 10:130727747-130727769 GAGGCTTCGAGCCTCTAGAGGGG + Intergenic
1077459371 11:2700917-2700939 CAGGGTGTGAACTTCTAGAGGGG - Intronic
1083040506 11:59680790-59680812 GCTGCTTAGAACTTCTAGACAGG + Intergenic
1086283532 11:85219057-85219079 GATGCTTAAGACTACTAGAGAGG + Intronic
1087838791 11:102901380-102901402 GAGGCTTATTACTTTTAGAAGGG - Intergenic
1093148499 12:15595088-15595110 CAGTCTTAGAACTATTAGAGGGG + Intronic
1096646150 12:53037473-53037495 GAGGTTTAGAAGTTGGAGAGTGG - Exonic
1097980846 12:65736788-65736810 GAGGCTCTGACCTACTAGAGAGG + Intergenic
1100177464 12:92047378-92047400 GTAGCTTAGAATCTCTAGAGGGG - Intronic
1103380637 12:120491501-120491523 GAGGGTTAGAGCTGCTAGGGTGG + Intronic
1106897459 13:34319918-34319940 TAGGCTTAGAATTTCCACAGTGG + Intergenic
1111048532 13:82847343-82847365 AAGCCTCAGCACTTCTAGAGGGG - Intergenic
1111677900 13:91409869-91409891 GACACTGGGAACTTCTAGAGAGG - Intronic
1111986674 13:95072922-95072944 GAGGTTCTGAAATTCTAGAGAGG - Intronic
1112952160 13:105012646-105012668 CAAGCCTAGAACTTCTAGAAAGG - Intergenic
1120325632 14:83021783-83021805 GATACTGAGGACTTCTAGAGGGG + Intergenic
1126354020 15:47775803-47775825 AAGGCTAAGAACTTCTATAAGGG - Intergenic
1126685410 15:51244563-51244585 GAGGTTTTAAATTTCTAGAGTGG + Intronic
1131772103 15:95749561-95749583 GAAGCTAAGAAGTTCAAGAGTGG + Intergenic
1134824978 16:17277357-17277379 GACACCGAGAACTTCTAGAGGGG - Intronic
1136592998 16:31228962-31228984 GAGGCCTAGAAGGTCAAGAGAGG - Intergenic
1146000683 17:29128493-29128515 GAGGCTGAGGACTCCTAGATGGG + Intronic
1149557170 17:57581622-57581644 CAGTCTTAGAACATGTAGAGGGG + Intronic
1152801271 17:82331836-82331858 GAGCCTCAAAACTTCTAGAGTGG + Intronic
1153091189 18:1345639-1345661 GAGGCTGAGAAGTTCAAGATTGG - Intergenic
1157491906 18:48129489-48129511 GAGGAGTAGAAATTCTAGAAGGG - Intronic
1159768251 18:72516874-72516896 CAAGCTTAGAACTCCCAGAGTGG - Intergenic
1166422217 19:42646347-42646369 GAAGCTAGGAACTACTAGAGGGG + Intronic
1168459516 19:56541665-56541687 GAGGCTCTGAAATTCTAGACAGG - Intronic
926648397 2:15315030-15315052 GAGGCTAAGACTTTCTAGGGTGG + Intronic
927266269 2:21155218-21155240 AAGGAATAGTACTTCTAGAGTGG - Intergenic
929323263 2:40572618-40572640 GGGCCCTAGAACTTCTAGAATGG - Intronic
931670112 2:64640249-64640271 GAGGCCTCCAACTCCTAGAGGGG + Intronic
935053304 2:99543028-99543050 TTGGCTAAAAACTTCTAGAGTGG - Intergenic
937639774 2:124198576-124198598 GACGCTGGGAACTCCTAGAGTGG - Intronic
942958803 2:181805073-181805095 GTGAATTAGAAGTTCTAGAGTGG + Intergenic
946317533 2:218927349-218927371 AGGGCTTGGAATTTCTAGAGGGG - Intergenic
1171874647 20:30562850-30562872 GATGCTTAGGACCTCTATAGAGG + Intergenic
1175039463 20:56033282-56033304 GAGGGTTAGAACTTCAACATAGG + Intergenic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178197661 21:30367020-30367042 GAGGCTCATAACTTCAAGTGTGG - Intronic
1179174324 21:38996351-38996373 GAGGTTAAGAACTTGAAGAGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
950414103 3:12858542-12858564 GAGGGCTGGCACTTCTAGAGGGG - Intronic
952267833 3:31803279-31803301 GAGGCTAAGGTCTTCTAGGGAGG + Intronic
953721226 3:45356885-45356907 GACGCTGAGGACTACTAGAGTGG - Intergenic
956190840 3:66606857-66606879 GAGGCTTAGAAATTTTAAATAGG - Intergenic
956220784 3:66900465-66900487 GAGGCTAAGAAGGTTTAGAGAGG - Intergenic
959992706 3:112646415-112646437 TGGGCTGTGAACTTCTAGAGGGG - Intronic
960396374 3:117142396-117142418 AAGACTTAGACTTTCTAGAGGGG - Intergenic
961316001 3:126036145-126036167 AAGGCTTAGAAAATCTAGAACGG - Intronic
966926633 3:184648672-184648694 CAGGCTTGGAAGTTCTGGAGGGG - Intronic
969969190 4:11028428-11028450 GTGGAATAGAACTTCTGGAGTGG - Intergenic
976480637 4:85540462-85540484 GCTGCTTATAACTTCTAGACTGG - Intronic
978367859 4:108001384-108001406 TAGGCTTAGAAGATCAAGAGAGG + Intronic
980001256 4:127491113-127491135 GAGCCTTATAACCTCTAGACAGG + Intergenic
980502013 4:133668413-133668435 GAGGCTTAGGAAGTCTGGAGCGG + Intergenic
981724568 4:147834082-147834104 GAGGCTGAGAAGTCCAAGAGTGG + Intronic
983806979 4:172006150-172006172 CAGTATTAGAACTTCTACAGAGG + Intronic
987831517 5:23101837-23101859 GACGCTGGGGACTTCTAGAGAGG + Intergenic
988277515 5:29100682-29100704 GAGCTTTATAACTTCTAGAATGG - Intergenic
990389438 5:55303944-55303966 GAGGCTTAAAATTTTAAGAGGGG - Intronic
998561358 5:143174859-143174881 GAGGCTTAGAAGTTCAATACAGG - Intronic
1001847781 5:174937121-174937143 GAGGCATAAAACTGCTACAGAGG + Intergenic
1002447567 5:179298665-179298687 GATGCCTAGAAATGCTAGAGGGG + Intronic
1004009670 6:11670207-11670229 GAGCCTCAGTACTTCTAGAGAGG + Intergenic
1004498313 6:16185493-16185515 GAGGCTTAGATCTAGTAAAGTGG + Intergenic
1004741206 6:18463152-18463174 CAGGCTTGGAATTCCTAGAGGGG + Intronic
1006844828 6:37054963-37054985 GAGGCTTTCTACTACTAGAGAGG - Intergenic
1010210066 6:73355575-73355597 AAAGTTTAGAACTTCTAGAGTGG + Intergenic
1012319428 6:97824271-97824293 GATGCTTGGGACTACTAGAGGGG + Intergenic
1015803609 6:137086448-137086470 GTGGCTTAGAACAGATAGAGGGG + Intergenic
1016764000 6:147772309-147772331 GATGCTCAGAACTTCAAGAAAGG + Intergenic
1023312360 7:38901252-38901274 GATGATTAAAAGTTCTAGAGAGG + Intronic
1025744637 7:64232186-64232208 GAGACTGAGAACCTCAAGAGTGG + Intronic
1029583399 7:101453500-101453522 GAGGCTGAGAGCATCTTGAGAGG - Intronic
1029958921 7:104669111-104669133 GAGGTTTAGAAGTTGGAGAGTGG - Intronic
1032938968 7:136767014-136767036 TTGTCTTATAACTTCTAGAGGGG + Intergenic
1034325357 7:150225835-150225857 GAAGCTCAGAACTTTTAGGGTGG - Intergenic
1034767846 7:153743418-153743440 GAAGCTCAGAACTTTTAGGGTGG + Intergenic
1035061778 7:156074793-156074815 GAAGCCAAGAACATCTAGAGCGG - Intergenic
1039927312 8:41947024-41947046 GAGTCTTCTCACTTCTAGAGTGG - Intronic
1043242880 8:77957943-77957965 AAGGTTTAGAAGTTGTAGAGGGG + Intergenic
1046816412 8:118588951-118588973 GAAGCTTAAAATTTCTATAGAGG + Intronic
1050922932 9:11229031-11229053 GAAACTGAGGACTTCTAGAGAGG - Intergenic
1051437597 9:17049378-17049400 GAGTCTTTGAACTTATACAGAGG - Intergenic
1051566131 9:18500401-18500423 GAGGCTAAGAACGTCTTGACTGG + Intronic
1052160022 9:25246448-25246470 GAAGCTGGGGACTTCTAGAGGGG - Intergenic
1052788224 9:32849866-32849888 GAGGCTTAAAACTTCAAGTACGG + Intergenic
1055939426 9:81635398-81635420 CAGACTTAGAACTTCTGGAATGG - Intronic
1056466594 9:86861827-86861849 GAGGCTGAGAATTTGTAGGGTGG + Intergenic
1057563493 9:96147391-96147413 GAGGTTTAGAAGTTGGAGAGTGG - Intergenic
1057906741 9:98989304-98989326 CAGGCTGAGAATTACTAGAGGGG + Intronic
1061058716 9:128239686-128239708 GAGTCTCAGAACTTCTCAAGAGG - Intronic
1203793426 EBV:163534-163556 GAGGCTGGGAACTCCTTGAGGGG + Intergenic
1188441985 X:30222176-30222198 GAGGCAAACAACTGCTAGAGAGG + Intergenic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1194245485 X:91506525-91506547 GACACTTTGGACTTCTAGAGAGG + Intergenic
1196079920 X:111620118-111620140 GAGGTTTAGAAGTTGGAGAGTGG + Intergenic
1200564455 Y:4747777-4747799 GACACTTTGGACTTCTAGAGAGG + Intergenic
1200862083 Y:8003664-8003686 TAGACTCAGAACTTCTACAGTGG + Intergenic
1202255650 Y:22917594-22917616 TAGACTCAGAACTTCTACAGTGG - Intergenic
1202408641 Y:24551343-24551365 TAGACTCAGAACTTCTACAGTGG - Intergenic
1202462143 Y:25118737-25118759 TAGACTCAGAACTTCTACAGTGG + Intergenic