ID: 1192831295

View in Genome Browser
Species Human (GRCh38)
Location X:74753411-74753433
Sequence GGGGATATTTCTGGACTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192831295_1192831300 3 Left 1192831295 X:74753411-74753433 CCTTCTAGTCCAGAAATATCCCC No data
Right 1192831300 X:74753437-74753459 GCACCAAGTTACTTACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192831295 Original CRISPR GGGGATATTTCTGGACTAGA AGG (reversed) Intronic