ID: 1192833591

View in Genome Browser
Species Human (GRCh38)
Location X:74776171-74776193
Sequence CTTCATTTACTTAAGGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192833591_1192833595 30 Left 1192833591 X:74776171-74776193 CCATGTACCTTAAGTAAATGAAG 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1192833595 X:74776224-74776246 GCGGCACAGACAGTGTTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 94
1192833591_1192833593 8 Left 1192833591 X:74776171-74776193 CCATGTACCTTAAGTAAATGAAG 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1192833593 X:74776202-74776224 TGTGTCTGATATGCATGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 115
1192833591_1192833594 11 Left 1192833591 X:74776171-74776193 CCATGTACCTTAAGTAAATGAAG 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1192833594 X:74776205-74776227 GTCTGATATGCATGAACAGGCGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192833591 Original CRISPR CTTCATTTACTTAAGGTACA TGG (reversed) Intronic
902035585 1:13455757-13455779 GGTCATTTTCTTAAGGTAGATGG + Intergenic
902716900 1:18279275-18279297 CTTCCTTAATTTAAGGTATATGG + Intronic
905758784 1:40535889-40535911 ATTCATTTACTTCAGCTTCAAGG - Intronic
907622263 1:55993425-55993447 ATTAATTTACTGAAGGTACTTGG - Intergenic
909803519 1:79845503-79845525 TTTCATATACTTGAGTTACAAGG - Intergenic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
915819866 1:159011039-159011061 CTTCAATTACTAAATGAACAAGG - Intronic
917722092 1:177795626-177795648 TATGATTTCCTTAAGGTACAAGG + Intergenic
917818430 1:178735278-178735300 CTTCATTTACATAAAGTTTAGGG + Intronic
918137109 1:181683440-181683462 CTTCTTTTATTTTAGGTTCAAGG + Intronic
919638423 1:200026245-200026267 CTGCATTTACTTAATTTAAAAGG + Intergenic
919663831 1:200273353-200273375 CTTCATATTCATAAGGCACAAGG + Intergenic
919999395 1:202785511-202785533 ATTCACATACGTAAGGTACAAGG - Intronic
920581915 1:207117754-207117776 GTTCTTTTCCTTCAGGTACAGGG + Intronic
921414520 1:214870841-214870863 CTTCATTGACCTCAGCTACATGG + Intergenic
923641551 1:235766503-235766525 CCTCAGTTAATTAAGATACATGG - Intronic
1064714100 10:18157734-18157756 ATTCATTTCCTTTAGCTACAAGG - Intronic
1065976260 10:30845436-30845458 TTTCATTTACTTGATGTTCATGG - Exonic
1068087591 10:52393676-52393698 TTTCAGAAACTTAAGGTACAGGG + Intergenic
1068450542 10:57180950-57180972 CTACATTTTCTTAAGGCAAAGGG - Intergenic
1069638367 10:69939493-69939515 CTGCATTTTTTTAAAGTACATGG + Intronic
1073463778 10:103681903-103681925 TTTCATTTTCTTAAGAGACAGGG - Intronic
1073502356 10:103951859-103951881 CATCATTTTATTAAGGAACAAGG - Intergenic
1073813229 10:107174528-107174550 TTTCAGTTACTTAAGGTATTTGG + Intergenic
1075761703 10:124862576-124862598 ATTTATTTACTTAAGAGACAGGG + Intergenic
1076195567 10:128515192-128515214 CATCAGTTACTTAAGTTACTCGG - Intergenic
1076870874 10:133193517-133193539 CTTTATTTATTTAAGAGACAGGG - Intronic
1080952639 11:37053412-37053434 ATTTCTTTACTTCAGGTACAAGG + Intergenic
1082212533 11:49522719-49522741 CTTAAGTGACTTAAGATACATGG - Intergenic
1086630387 11:89011035-89011057 CTTTATTAACTTATGGTGCAAGG + Intronic
1088013452 11:105031724-105031746 ATTTATTTACTTAATATACATGG + Intronic
1088073545 11:105819015-105819037 CTTCATCTTTCTAAGGTACATGG + Intronic
1088800834 11:113305647-113305669 CATCATTTATTTAGGGTACTTGG - Intergenic
1092897616 12:13028551-13028573 CTTCATGTACTTAACGCAAAGGG + Intergenic
1093352642 12:18122512-18122534 CATCATTTATTTTAGATACAGGG + Intronic
1095122009 12:38430649-38430671 CTTCAGTTATTGAAGATACAGGG + Intergenic
1095850764 12:46801687-46801709 ATTCATTTATCTATGGTACAGGG - Intronic
1097289918 12:57906101-57906123 CTTCACTTACCTCAGGTAGAGGG - Intergenic
1098547207 12:71724908-71724930 CATTATTTACTTAAGGAAAATGG + Intergenic
1100305572 12:93347096-93347118 CTTAATTTACTTAAGCCAGATGG + Intergenic
1100374140 12:93996724-93996746 CATCAGTTCCTTAAGGGACATGG + Intergenic
1104490365 12:129188869-129188891 CTTAATCAACTCAAGGTACATGG - Intronic
1104614256 12:130255272-130255294 TTTCATTTTCTTAAGAGACAGGG + Intergenic
1105247066 13:18662965-18662987 CTCCATTTACTTCAGACACAAGG - Intergenic
1105383419 13:19908421-19908443 CTTCATTTATTTTAGAGACAGGG - Intergenic
1105987981 13:25588442-25588464 CGGCATTTACCTAAGGGACAAGG - Intronic
1108368835 13:49746772-49746794 TTTCATTTACTGAGGGTACTAGG - Intronic
1108808697 13:54192658-54192680 ATTCAGTTACTTAAGTCACATGG + Intergenic
1110130572 13:72003816-72003838 CTTCATTTGCTTATTATACATGG + Intergenic
1111514844 13:89315911-89315933 TTTCAAATGCTTAAGGTACAGGG - Intergenic
1112202802 13:97293491-97293513 TTTCCTGTTCTTAAGGTACAAGG + Intronic
1113351681 13:109535705-109535727 CTTCATTTGTTTAAAGAACAGGG + Intergenic
1114336810 14:21698749-21698771 ATTCATTTACTTATGGTCTATGG + Intergenic
1115088675 14:29547846-29547868 CTTTATTTCCTTAAGATACAAGG + Intergenic
1116184178 14:41575581-41575603 GTCTATTTACTTAAGATACAGGG + Intergenic
1116505902 14:45681051-45681073 CTGCTTTTACTTAAGGTGGAAGG + Intergenic
1118014470 14:61644432-61644454 CTTCATTTACTTTAACCACATGG + Intronic
1126518762 15:49564954-49564976 CAACATTTACTTTAGGTTCAGGG - Intronic
1129258743 15:74350676-74350698 CTCCATTTACATAAGGCATATGG + Intronic
1129585409 15:76858469-76858491 TTTCTTTTATTTTAGGTACAGGG + Intronic
1130813505 15:87406481-87406503 CTTCATTTATTTATTGAACAAGG - Intergenic
1131666572 15:94577343-94577365 CTTCATTTAGTTAAGTCACCAGG - Intergenic
1134430510 16:14200216-14200238 ATTCATATACTTAAGCTACCAGG - Intronic
1135410233 16:22228545-22228567 CTTTATTTAATTCAGGTACCCGG + Intronic
1135505866 16:23035647-23035669 GTTCATTTACTTATTGTCCATGG + Intergenic
1135634416 16:24061892-24061914 TTTTATTTATTTAAGGTGCAGGG - Intronic
1141269250 16:82523747-82523769 CTTCATTTTCTGAAGCAACAGGG + Intergenic
1143570958 17:7758137-7758159 GTTTATTTACTTAATTTACATGG - Intronic
1144994712 17:19259685-19259707 CTTCATTTAATCAGGGAACAGGG - Intronic
1147397521 17:40156231-40156253 CTTCATGTAATTAAGGGAAATGG + Intronic
1148599395 17:48882633-48882655 CTGCATTAATTAAAGGTACATGG - Intergenic
1148947354 17:51275377-51275399 CTTTATTCTCTTAGGGTACATGG - Intronic
1151343829 17:73489329-73489351 CTTCATTCCCTTAAGGTCCCTGG - Intronic
1152326709 17:79645714-79645736 CCTCCTTCACTTAAGGCACAGGG + Intergenic
1154054486 18:10999929-10999951 CTTCATGTACTTAACCTACAAGG - Intronic
1154441781 18:14396157-14396179 CTTCATTTACTTCAGACACAAGG + Intergenic
1155071821 18:22323751-22323773 CTTCATTTATATGAGGTACATGG - Intergenic
1155354922 18:24942635-24942657 CTTCAGTTACTTATGCTACAAGG + Intergenic
1158561840 18:58521044-58521066 CTTCTTTATCTGAAGGTACAAGG + Intronic
1162499481 19:11043645-11043667 TTTCATTTTTTTAAGATACAGGG - Intronic
1166620618 19:44297047-44297069 TTTCATTTCCTTAAGGTATAAGG - Intronic
1168097148 19:54122398-54122420 CTTCAGTTACTAAAGGAAGAAGG + Intronic
1168723288 19:58566799-58566821 CTTTATTTATTTAAAGGACAGGG - Intronic
926360037 2:12078314-12078336 TTTTATTTATTTAAGGTGCAGGG + Intergenic
927440750 2:23115243-23115265 CTTCCTTTACTTCAGGGGCAGGG + Intergenic
927751681 2:25675046-25675068 CTTCATATATGTAAGGTAAAAGG - Intergenic
928717429 2:34077501-34077523 CTTCATTTTCTTAGGGACCAAGG + Intergenic
933253274 2:80052658-80052680 CTTCAGTTACTAAATGTACCTGG - Intronic
936680163 2:114760650-114760672 CTGTATTTACTTATGCTACAGGG - Intronic
937827553 2:126383154-126383176 GTTCATTTACTTACTGTCCACGG + Intergenic
939259798 2:139792550-139792572 GTTCATTTTCTTTAGGTATAGGG + Intergenic
939701245 2:145394255-145394277 TTTCATTTATATAAGGTTCAAGG - Intergenic
941174493 2:162180111-162180133 TTTAAATTACTTAAGGTACAGGG + Intronic
942479154 2:176364031-176364053 CTTTAATGCCTTAAGGTACAGGG - Intergenic
942506738 2:176649715-176649737 TTGGCTTTACTTAAGGTACATGG + Intergenic
942707809 2:178796513-178796535 CTTCATTTACAAAATGTAAATGG - Intronic
942932899 2:181517470-181517492 CTTGATTTGTTTAAGTTACATGG + Intronic
943532435 2:189100059-189100081 CTAAGTTTATTTAAGGTACAAGG + Intronic
944038539 2:195327740-195327762 TTTCATATGCTTAAGGTAAAGGG - Intergenic
944299448 2:198106456-198106478 CATCATTTGCTTAAGGAGCAGGG + Intronic
945317428 2:208385056-208385078 ATCCATTTTCTTAAAGTACAGGG - Intronic
1170334556 20:15253897-15253919 CCTCATTTATTTTAGGTTCATGG + Intronic
1173382240 20:42556226-42556248 CTTAAGTTACTTGAGGCACATGG + Intronic
1176454288 21:6895020-6895042 CTCCATTTACTTCAGACACAAGG - Intergenic
1176832462 21:13760068-13760090 CTCCATTTACTTCAGACACAAGG - Intergenic
1178573773 21:33766003-33766025 CTTCTTTTAGGTAAGGAACATGG + Exonic
1182530736 22:30954379-30954401 CTTGATTTACTTCAAGTACCAGG - Intronic
949837743 3:8287423-8287445 CTTCATTTACATACTGTCCATGG - Intergenic
950174074 3:10860021-10860043 CTTCATTTACTTGGGGTTCTTGG + Intronic
950249779 3:11454633-11454655 CTTTATTTACTCAAGCTAAAAGG - Intronic
951454892 3:22879662-22879684 TTTCAGTTTCTTAAGGTAGAAGG - Intergenic
952721130 3:36533857-36533879 CTTCTTTTATTTTAGGTTCAGGG + Intronic
953516714 3:43600179-43600201 ATTCATTTACTTATGGTCTATGG + Intronic
955164182 3:56494422-56494444 CTTCTTTTTTTTAAGATACAAGG - Intergenic
955363718 3:58294065-58294087 CTTGATTTAATTATGGTCCAAGG - Exonic
959450658 3:106495662-106495684 TTTCAATTACACAAGGTACAAGG + Intergenic
959806525 3:110561588-110561610 CTCCATTTACTTAAGGGCTAGGG + Intergenic
960213305 3:114998184-114998206 CCTCATTTTCATAATGTACATGG - Intronic
960507682 3:118513202-118513224 TTTCCTTTCCTTCAGGTACAGGG - Intergenic
963404230 3:144842410-144842432 GGTCATTTACTTAATGTACAAGG - Intergenic
963408617 3:144902079-144902101 CTTCCTCTTCTTAACGTACAGGG + Intergenic
965474230 3:169134378-169134400 CTTTATTTACTGGAGGTAAAAGG + Intronic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
966439201 3:179924759-179924781 CTTAATACACTTAAGGTATAAGG - Intronic
966570262 3:181433786-181433808 CTTTATTTGCTTAGTGTACAGGG - Intergenic
967673315 3:192265669-192265691 ATTCATTTACTTATGGTATATGG + Intronic
972963249 4:44479264-44479286 CTTCATTTTCCTTATGTACATGG + Intergenic
973070655 4:45854511-45854533 CTACATAAACTTAAGGTAAAGGG - Intergenic
973901770 4:55482102-55482124 CTACTTTTACTTTAGGTTCAGGG + Intronic
973983764 4:56329403-56329425 CATCCTTTATTTAAGGTACATGG - Intergenic
976111671 4:81681683-81681705 GTTTTTTTACTTTAGGTACATGG - Intronic
977112470 4:92975350-92975372 CTTCAATTCCTTAAGATACTTGG + Intronic
977121182 4:93103934-93103956 CAGCTTTTACTTTAGGTACAAGG + Intronic
977128504 4:93201608-93201630 CTTAATTTAGTTAAGCCACAAGG + Intronic
977448132 4:97158126-97158148 TTTCATTTCCTCCAGGTACAGGG + Intergenic
979212511 4:118122307-118122329 TTTCATTTACTTAAGATGGAGGG + Intronic
979401914 4:120259545-120259567 TTACTTTTACTTTAGGTACAAGG - Intergenic
980473261 4:133277042-133277064 CTTTATTTACTTTATGTATATGG + Intergenic
980565397 4:134532792-134532814 CTTCATTGAATTAAGTTAGAGGG - Intergenic
980578865 4:134722032-134722054 CTACATTTATTTTAGGTTCAGGG - Intergenic
980966776 4:139529187-139529209 CTTCATTTACTTCTCCTACAAGG + Exonic
982011750 4:151112430-151112452 CTTCATTCACTTTAGTTGCATGG - Intronic
982150555 4:152451340-152451362 TTTCATTTCCTTAAGATACAAGG + Intronic
982348577 4:154389103-154389125 ATTCATTTACTTATTGTCCACGG - Intronic
982911650 4:161149364-161149386 CTGTGTTTACTTAAGGTGCAAGG - Intergenic
984974044 4:185214564-185214586 TTTTATTTTTTTAAGGTACAGGG - Intronic
986046682 5:4044729-4044751 CAACATTTACTTAAGGCCCAAGG - Intergenic
987001650 5:13666264-13666286 CTTTCTTTACTCTAGGTACATGG - Intergenic
987490478 5:18574880-18574902 CTGCATTTTCTGAAGTTACATGG + Intergenic
987911075 5:24146480-24146502 CTTCCTATACTTCAGCTACATGG + Intronic
990982338 5:61613483-61613505 ATACATTTTTTTAAGGTACAAGG - Intergenic
991452954 5:66772157-66772179 CTTCATGTCCTTGAGGTACTGGG + Intronic
991567932 5:68024076-68024098 CTTCATATGCCTGAGGTACAGGG - Intergenic
993500815 5:88664764-88664786 TTTCATTTACTTCATGTCCAGGG - Intergenic
995156807 5:108924416-108924438 GTTTCTTTACTTAATGTACAAGG + Intronic
996278101 5:121693383-121693405 ATTCATTTTCATAAGGTCCATGG + Intergenic
997501648 5:134379724-134379746 CTTCATGTACTTAAACTAAACGG + Intronic
998682617 5:144487167-144487189 CTTCATTAAATTTAGGCACAGGG + Intergenic
999103167 5:149044520-149044542 CTTAATTTAGGTATGGTACAAGG - Exonic
999926695 5:156386607-156386629 CTTCATTTCATTAAGATATATGG - Intronic
1003738356 6:8904759-8904781 CCTCATTTACTCAATCTACATGG - Intergenic
1003815721 6:9837897-9837919 TTTCCTTTATTTAAGGTTCAGGG - Intronic
1004226038 6:13785169-13785191 ATTCATTCACTTTAGATACAGGG + Intergenic
1004226513 6:13789667-13789689 CTTCATTTACTTTTTATACAAGG - Exonic
1005372185 6:25145088-25145110 ATTTATTTATTTAAGATACAGGG - Intergenic
1006181593 6:32156570-32156592 ATTCATTCACATATGGTACATGG - Intronic
1006269919 6:32956404-32956426 CTTCATTTACATATTGTGCATGG - Intronic
1007033278 6:38648706-38648728 TTTCTTTAACTGAAGGTACATGG + Intergenic
1008612809 6:53199884-53199906 CTGCTTTTATTTAAGGTGCAGGG + Intergenic
1009023324 6:57968542-57968564 CTTCATTGACCTCAGTTACATGG - Intergenic
1009286384 6:61823749-61823771 CAACCTTTACTTCAGGTACAAGG - Intronic
1011640130 6:89411047-89411069 CTGCATTTTCTTAAGGTGTAAGG - Intronic
1012056614 6:94420456-94420478 CATCATTTGCATTAGGTACATGG + Intergenic
1013984467 6:116173499-116173521 CTTCATTCACTTCATGTAGAGGG + Intronic
1015760304 6:136652228-136652250 GCGCATTTACTTAAGGTACAGGG + Intronic
1019076821 6:169394574-169394596 CTTCATTTACTTACCCTTCAGGG + Intergenic
1019637562 7:2084251-2084273 CTTCATTTCCTCAAAGTCCAGGG + Intronic
1020464237 7:8458497-8458519 GTTCATTTTCTTAAGGAATAAGG - Intronic
1022125678 7:27353924-27353946 CTTCCTTTTATTAAGGAACATGG + Intergenic
1023291941 7:38678042-38678064 CTTCTTTTATTTAAGCTACTGGG - Intergenic
1023657442 7:42439085-42439107 CCACATTAACTTAAGGTAAAGGG - Intergenic
1025152035 7:56563685-56563707 CTTCATTTACTTCTGGTCCTGGG + Intergenic
1026235518 7:68523365-68523387 ATTTATTTATTTAAGGGACAGGG - Intergenic
1026351640 7:69521242-69521264 TTTCATTTATCTAAGATACATGG + Intergenic
1026651462 7:72219229-72219251 CTTCATTTTCTTAAGAGACAAGG + Intronic
1028225926 7:88252651-88252673 ATTTATTTACTTAAGAGACAGGG + Intergenic
1030957444 7:115872667-115872689 CAGCATTTACTTAGGGGACACGG - Intergenic
1031257025 7:119466111-119466133 GTTCATTTATTTAAGGTACTTGG - Intergenic
1031947750 7:127858955-127858977 CTGCATTTACATAAACTACAGGG + Intronic
1038297436 8:26307910-26307932 TTTCATTTACATATAGTACATGG - Intronic
1039270080 8:35870308-35870330 CTTCTTTTCCTCAGGGTACATGG - Intergenic
1039666633 8:39540526-39540548 CTACTTTTACTTTAGGTTCAGGG + Intergenic
1041181130 8:55249372-55249394 CTTTATCTACTCAAGTTACAAGG + Intronic
1041398852 8:57419893-57419915 CTTGATTTAATTGAGGTTCAAGG - Intergenic
1044005463 8:86932072-86932094 TGTCATTTACTTAAGATACCAGG + Intronic
1044515647 8:93135315-93135337 ACTCATTTATTTATGGTACAAGG - Intronic
1048398074 8:134034026-134034048 CTTGATTTACTTAGCTTACAAGG + Intergenic
1050415817 9:5416292-5416314 CTTCATTATCTTAAGGAACCAGG + Intronic
1051357338 9:16251945-16251967 TTTCATTTACATGAGGTACCTGG + Intronic
1051598473 9:18848803-18848825 ATTCATTTACTTATGGTCTATGG - Intronic
1052323624 9:27194205-27194227 CTCCATTTACTAAAAGTAGAAGG + Intronic
1052702344 9:31952279-31952301 CAACTTTTACTTAAGTTACAGGG - Intergenic
1053193090 9:36090816-36090838 TTACTTTTACTTAAAGTACATGG - Intronic
1053678174 9:40460031-40460053 ATTCACTTACTTAAGGTTTAAGG + Intergenic
1054285551 9:63164912-63164934 ATTCACTTACTTAAGGTTTAAGG - Intergenic
1054291251 9:63295568-63295590 ATTCACTTACTTAAGGTTTAAGG + Intergenic
1054506446 9:65916265-65916287 ATTCACTTACTTAAGGTTTAAGG - Intergenic
1054560010 9:66699411-66699433 CTTCACTTACCTCAGGTAAAAGG - Intergenic
1055393199 9:75845519-75845541 CTTCATTTAATTGAGGGTCACGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057813631 9:98277924-98277946 CTTCTTTTACTTAAGATAATGGG - Intergenic
1058780965 9:108334649-108334671 CTTCATTTACTGTAAGAACAAGG + Intergenic
1186657256 X:11627307-11627329 CTTCATTTACATAAGTTCTATGG - Intronic
1187320369 X:18232460-18232482 CTTTATTTATTTAAGAGACAGGG + Intergenic
1188433525 X:30134493-30134515 CTTCATTTACCCAAAGTAAATGG - Intergenic
1192257732 X:69479198-69479220 CAACATTTACTTTAGGTTCAGGG - Intergenic
1192818895 X:74622351-74622373 CCTCAGTTAATTAAGTTACAGGG - Intergenic
1192833591 X:74776171-74776193 CTTCATTTACTTAAGGTACATGG - Intronic
1194147553 X:90281721-90281743 TCTCATCTACTTAAGGAACACGG - Intergenic
1196929883 X:120670912-120670934 TTTCATTTACATGAGGTACGTGG + Intergenic
1198188332 X:134277850-134277872 CTTTATTTATTTAAGAGACAAGG - Intergenic
1198434611 X:136604221-136604243 CTACATTTCCTTAAGGTAGAAGG - Intergenic
1200493948 Y:3858482-3858504 TCTCATCTACTTAAGGAACATGG - Intergenic
1200514523 Y:4127563-4127585 CCACATTAACTTAAGGTAAAGGG + Intergenic
1201938012 Y:19428321-19428343 CTTGATTTACATAAGGCACAAGG + Intergenic