ID: 1192834410

View in Genome Browser
Species Human (GRCh38)
Location X:74783950-74783972
Sequence TTGTATGCTAGGATGTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192834410_1192834417 21 Left 1192834410 X:74783950-74783972 CCCCTCCACATCCTAGCATACAA 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1192834417 X:74783994-74784016 GTCATTTCCGTCATCCTTAGAGG 0: 1
1: 0
2: 0
3: 3
4: 79
1192834410_1192834418 22 Left 1192834410 X:74783950-74783972 CCCCTCCACATCCTAGCATACAA 0: 1
1: 0
2: 0
3: 15
4: 138
Right 1192834418 X:74783995-74784017 TCATTTCCGTCATCCTTAGAGGG 0: 1
1: 0
2: 2
3: 6
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192834410 Original CRISPR TTGTATGCTAGGATGTGGAG GGG (reversed) Intronic
902171756 1:14617109-14617131 AGGCATGCTAGGATGTGGTGGGG - Intronic
903711458 1:25328092-25328114 TTGTATGGTAGGCTGTGGTGTGG + Intronic
903715490 1:25363337-25363359 TTGTATGGTAGGCTGTGGTGTGG - Intronic
909136474 1:71806831-71806853 TGGTATGCTAGGATGTAGGATGG - Intronic
914521896 1:148425168-148425190 TTATTTACTATGATGTGGAGTGG - Intergenic
919564947 1:199172936-199172958 TTGTATTCTTGGATATGGACTGG - Intergenic
920511948 1:206558010-206558032 TTCTAAGCTAGGATTTGGGGAGG - Intronic
922188555 1:223297206-223297228 CTGTCTGCTAACATGTGGAGAGG + Intronic
922413220 1:225395780-225395802 TTGCATTCTGGGATTTGGAGTGG + Intronic
1069506959 10:69008088-69008110 TTGTATAGTAGGATGTAAAGGGG + Intronic
1071513505 10:86282179-86282201 CTGTATGCTAGGATTTGCAGGGG - Intronic
1071601388 10:86960203-86960225 TTGTTTCCTGGGGTGTGGAGTGG - Intronic
1072135497 10:92542020-92542042 GTGTTTGTTTGGATGTGGAGGGG - Intronic
1072460648 10:95615590-95615612 GTGTAAGCTAGGAAGTGGTGGGG + Intronic
1074788047 10:116859100-116859122 TTTTTTGGTAGGAGGTGGAGGGG - Exonic
1075711534 10:124533399-124533421 TTGTGTCCTCGGATGGGGAGGGG + Intronic
1076865586 10:133164802-133164824 TTGTCTGCTGGGATGTGGCGGGG + Intronic
1082838144 11:57666980-57667002 TTGTATTCTAGGATTGGGTGAGG + Intergenic
1083547064 11:63556700-63556722 TTGTATGATAGGAGAAGGAGAGG - Intronic
1089394369 11:118126305-118126327 TTGGAAGGGAGGATGTGGAGAGG + Intergenic
1089691326 11:120188500-120188522 TTGTGTGTTTGGATGTTGAGTGG - Intergenic
1093333658 12:17873982-17874004 TTGAATGTTAGGATCTGGATTGG - Intergenic
1095972229 12:47910180-47910202 TTGTTTGCTTGGATTTGGACAGG - Intronic
1097111365 12:56660961-56660983 TGGTATGCTTGGTGGTGGAGGGG - Intergenic
1100888766 12:99101145-99101167 TTGTAAGCGATGATGTGAAGTGG + Intronic
1103302277 12:119937214-119937236 ATGTAGGCTAGGATGGGGAGGGG - Intergenic
1108561305 13:51646815-51646837 TTGCAGGCTAGGATGGGTAGGGG + Intronic
1108867424 13:54939793-54939815 TTGTATTGTATGTTGTGGAGAGG + Intergenic
1110089361 13:71425500-71425522 TTGTATGCAAGAATATAGAGGGG + Intergenic
1110972284 13:81780263-81780285 ATGTATTATGGGATGTGGAGAGG - Intergenic
1110984242 13:81943265-81943287 TTGTATGGTAGGGTGTGATGGGG + Intergenic
1111979180 13:94999100-94999122 TTGTATGCAAGGATATACAGTGG + Intergenic
1112047017 13:95608083-95608105 TTGTATGCTGGGAAGAGGAATGG + Intronic
1112234597 13:97624244-97624266 ATGTATGCGAGGATATTGAGTGG + Intergenic
1112751026 13:102583399-102583421 TTGTATGTTGTGATGGGGAGAGG - Intergenic
1113331671 13:109333393-109333415 TTCCAAGCTAGAATGTGGAGAGG - Intergenic
1121591407 14:95114764-95114786 TGGTAAGCTAGGATGAGGAGAGG + Intronic
1122061528 14:99139495-99139517 TTGCATCCTGGGCTGTGGAGTGG + Intergenic
1124574717 15:30897092-30897114 TTGTGTGTTCGGATGTGGGGGGG - Intergenic
1124928273 15:34093675-34093697 TTGTAAGCTTGGAAATGGAGGGG - Intronic
1125275292 15:37982982-37983004 TTTTAGGCTACGATGAGGAGGGG - Intergenic
1125794193 15:42392375-42392397 GTGGATGCTGGGATGTGGGGTGG - Intronic
1127536572 15:59895313-59895335 GTGTTTGCTGGAATGTGGAGTGG + Intergenic
1127911260 15:63418056-63418078 TTCTATGGTGGGATGGGGAGTGG - Intergenic
1128775771 15:70318960-70318982 TTGTATGCCAGGCTGAGCAGTGG - Intergenic
1129074302 15:72978513-72978535 TTGTAAGCAAGGATGTTCAGTGG + Intergenic
1129707784 15:77804621-77804643 GTGTGTGCAAGGATGTGCAGGGG + Intronic
1130190401 15:81729836-81729858 TGGTATGTTAGGATGTGTCGGGG + Intergenic
1132778009 16:1606865-1606887 CTGTATGCTTGTATGTGGGGGGG - Intronic
1133048273 16:3101231-3101253 TTGTCTGCCAGGGTGTGCAGGGG + Intergenic
1133859003 16:9576482-9576504 TTGTGTGCCATGCTGTGGAGTGG + Intergenic
1134124591 16:11607869-11607891 TTGGATGCCATGATGTGGGGAGG - Intronic
1135055269 16:19226803-19226825 TTGTAAGCTTAGATGAGGAGAGG + Intronic
1135725103 16:24848182-24848204 ATGAATGCTAGTATGTGGTGGGG + Intronic
1137685797 16:50385955-50385977 TGGTATGATGGGATGTGGGGTGG + Intergenic
1147138708 17:38449676-38449698 CTGTGTGCGAGGTTGTGGAGTGG + Intronic
1147261889 17:39213604-39213626 GGGTCTGCTAGGATGGGGAGGGG - Intronic
1147789063 17:43001663-43001685 TTGGGTGCTGGGATGTGGTGGGG + Intronic
1150034393 17:61778039-61778061 TTGTATGCCAGGAAATGGAGTGG + Intronic
1150159698 17:62885594-62885616 TGGTATGCTTGTATATGGAGTGG - Intergenic
1150808399 17:68337108-68337130 TTCTCTGCTGGGATGTGGGGTGG + Intronic
1153710617 18:7794978-7795000 TTGTAAGCCAGGATGTAGACTGG - Intronic
1155505855 18:26532088-26532110 TGGTATGCTGGGATGAGGATGGG + Intronic
1157578907 18:48762008-48762030 ATGTCTGCTTGGATGTAGAGAGG - Intronic
1159623886 18:70669742-70669764 TTGGATGACTGGATGTGGAGAGG + Intergenic
1161967006 19:7554539-7554561 TTGGATGCTAGGGTGGGAAGGGG - Exonic
1164403605 19:27921462-27921484 TTGTATTTTAGGATGTAGTGAGG + Intergenic
1165502618 19:36202171-36202193 TTGTGTGGTAGGACATGGAGAGG - Intronic
1166496380 19:43305894-43305916 TTGCACGCTAGGAGGTGCAGAGG - Intergenic
927492029 2:23527048-23527070 TAGGAAGCTAGGATGGGGAGTGG + Intronic
928380331 2:30812233-30812255 TTGTATGCCAGGATTTGTAATGG - Intronic
931248652 2:60511292-60511314 TTGTATGCTAGGGTGGGAAAGGG - Intronic
931951163 2:67363691-67363713 TTGGAAGGTGGGATGTGGAGTGG + Intergenic
933000781 2:76919765-76919787 TTGTATGCTATAATGTGCATTGG - Intronic
933766128 2:85710970-85710992 TTCTCTTCTAGGATGTGGTGTGG - Intergenic
938264561 2:129917694-129917716 TTGTATGGGAGGATGAGGACTGG - Intergenic
940811570 2:158248740-158248762 TTGCATTCTAAGATGAGGAGAGG + Intronic
941413369 2:165188074-165188096 CTTTTTGCTGGGATGTGGAGGGG + Intronic
942944076 2:181654608-181654630 TGATATGGTAGGATGTGGTGGGG - Intronic
943884830 2:193203129-193203151 TTGTTTGCTAGTATGTGGAAAGG + Intergenic
947247116 2:228061113-228061135 TCCTATGCTATGCTGTGGAGGGG - Intronic
1169307797 20:4508209-4508231 TTGTATGCTAGAAGGGTGAGAGG + Intergenic
1169780078 20:9300302-9300324 TTGTATGGTTGGATGGGGAAGGG + Intronic
1172869939 20:38129687-38129709 TGGGCTGCTGGGATGTGGAGGGG + Exonic
1173634931 20:44547075-44547097 TTGTATGTTAGGATGTACAGAGG - Intronic
1174582792 20:51584317-51584339 TTTATTGCCAGGATGTGGAGTGG - Intergenic
1175533303 20:59689554-59689576 TTGGATACTAGGATGTTGTGTGG + Intronic
1178600744 21:33992371-33992393 CTGTTTACTGGGATGTGGAGAGG + Intergenic
1182402760 22:30094392-30094414 TTGGATGCTAGGAGGTCTAGGGG + Intronic
1184989444 22:48157043-48157065 CTGTAAACTAGGAGGTGGAGCGG + Intergenic
1203298215 22_KI270736v1_random:58801-58823 TGGAATGCTTTGATGTGGAGTGG + Intergenic
949418627 3:3840644-3840666 ATGTCTTCTAGGATGTGGAGAGG + Intronic
951061201 3:18209051-18209073 AGTAATGCTAGGATGTGGAGAGG + Intronic
954221088 3:49154379-49154401 GTGGATACAAGGATGTGGAGAGG - Intergenic
956863378 3:73346526-73346548 TTGTATTCTAGGTGGTGGTGGGG + Intergenic
957553449 3:81735969-81735991 TAGTAGGCTTAGATGTGGAGTGG - Intronic
958707539 3:97674885-97674907 TTCTCAGCCAGGATGTGGAGTGG + Intronic
960917719 3:122713971-122713993 TTGTATGGGAGGCTGTGGAGAGG + Intronic
962619136 3:137159636-137159658 TTGTTTGCATGGATGAGGAGTGG + Intergenic
962924698 3:139980994-139981016 GTGTGTGCTATGATGTGGGGAGG + Intronic
966957794 3:184901916-184901938 GTGCTTGCAAGGATGTGGAGCGG - Intronic
967596424 3:191330087-191330109 TTGAAGGCTGGGAAGTGGAGAGG + Intronic
971044620 4:22791500-22791522 TTGTATGGTAGGATGGGGTTAGG - Intergenic
972738394 4:41866915-41866937 TTATGGGCTGGGATGTGGAGCGG - Intergenic
977132273 4:93255456-93255478 GTGTTTGCTATGATGTGGATTGG + Intronic
977248978 4:94667504-94667526 GTGTATGGTAGGATGTGCATAGG + Exonic
977256406 4:94745692-94745714 TTGTTGGCAAGGATGTGGAGAGG + Intergenic
977848527 4:101795423-101795445 TTTTTTTCTAGGATGGGGAGTGG + Intronic
979861052 4:125694368-125694390 TTGTATGTGAGGATGGGTAGTGG + Intergenic
980191658 4:129532576-129532598 TTGCATTGTAGGATGTTGAGTGG + Intergenic
980211794 4:129798037-129798059 ATGTATGCTAGCATGTGGGAAGG + Intergenic
980618652 4:135268053-135268075 CTGTATCCTATGATGTGGTGAGG + Intergenic
984011948 4:174381962-174381984 ATGTATGGTAGAAGGTGGAGGGG + Intergenic
984245587 4:177271838-177271860 TTCCATGCTTGGGTGTGGAGAGG - Intergenic
986821431 5:11470821-11470843 TGGGATGATAGGATTTGGAGAGG + Intronic
986976884 5:13405212-13405234 TTGCATGAGAGGAGGTGGAGTGG + Intergenic
992862376 5:80924537-80924559 GTGTACGCAAGGATGTGGATTGG - Intergenic
1004022533 6:11788259-11788281 TGGTATGTAAGGATGAGGAGAGG - Intronic
1004628127 6:17395533-17395555 TTCTGTGCTAGAATCTGGAGAGG + Intronic
1006282790 6:33068899-33068921 TTGGATGTTAGGACGAGGAGAGG + Intronic
1007380404 6:41486775-41486797 TTGCATGCCAGGAGGTGGATGGG + Intergenic
1010751667 6:79622284-79622306 TTGTAGTCAAGGTTGTGGAGGGG - Intergenic
1013180159 6:107710427-107710449 TTGTATGTGAGGAGGTGAAGCGG + Intronic
1013180783 6:107715319-107715341 TTGTATGTGAGGAGGTGAAGCGG - Intronic
1013563383 6:111329425-111329447 TTGGAAGCTAAGATGTGGTGCGG - Intronic
1014985628 6:128004029-128004051 TTGTATGCTTGTATGTAAAGAGG - Intronic
1018152344 6:160951988-160952010 GTGTGTGCTGGGAGGTGGAGGGG - Intergenic
1018849594 6:167577409-167577431 GTGTGTGCTGGGATGTGGCGTGG + Intergenic
1019694350 7:2436809-2436831 GTGTTTGCAGGGATGTGGAGGGG + Intergenic
1022626891 7:32045784-32045806 TTGTATCCTAGGATGGGATGTGG - Intronic
1023138742 7:37080107-37080129 CTGGATGATTGGATGTGGAGTGG - Intronic
1023173332 7:37411230-37411252 TTGTTTGCTAAGATGTGGACAGG - Intronic
1026239575 7:68560958-68560980 TTGTATTCCAGCATTTGGAGTGG - Intergenic
1027222573 7:76223426-76223448 TTCAATGCCAGGATTTGGAGTGG + Intronic
1027459923 7:78439481-78439503 TTGTATGACAGCATTTGGAGAGG + Intronic
1030926890 7:115468372-115468394 GTGTGTGCTAGGTTGGGGAGTGG - Intergenic
1032214528 7:129947615-129947637 TTGTGTGCTAGGATGTATATGGG - Intronic
1037974459 8:23199906-23199928 TTCTCTTCTAGGTTGTGGAGGGG - Exonic
1042520798 8:69709223-69709245 CTGTTTGCTAGGATGCAGAGAGG + Intronic
1048232754 8:132659906-132659928 GTGTATGGGAGGATGGGGAGAGG - Intronic
1052438437 9:28461677-28461699 TTATTTGCAGGGATGTGGAGAGG + Intronic
1055726352 9:79233758-79233780 TTGGAGGTTAGGATGTGGTGGGG + Intergenic
1057712737 9:97462026-97462048 TTTTATTCTAAGATGTGGTGTGG + Intronic
1059770360 9:117417864-117417886 TTCTGTGCTATGATTTGGAGTGG + Intergenic
1061278871 9:129585659-129585681 TTGGAAGCTAGGATCTGAAGAGG - Intergenic
1186779203 X:12896312-12896334 TTGTATGCAAAGGTATGGAGTGG + Intergenic
1186836691 X:13445405-13445427 TTGTATGCTGTCATGTGGAGAGG - Intergenic
1187343434 X:18441850-18441872 TTGTTTGCTTGGAGGTGGGGAGG + Intronic
1187823462 X:23312206-23312228 TTGGGTGCTGGGATGTGGTGAGG - Intergenic
1188993762 X:36856474-36856496 TTGTATACTGGGATGGGGTGTGG + Intergenic
1192618104 X:72648971-72648993 TTCTATGGCAGGATTTGGAGAGG + Intronic
1192834410 X:74783950-74783972 TTGTATGCTAGGATGTGGAGGGG - Intronic
1193043450 X:77027727-77027749 TTGTATGCTAGGAGGAGATGTGG + Intergenic
1201665008 Y:16441376-16441398 TTCTATTCTAGGTTGTGGAGGGG + Intergenic