ID: 1192840558

View in Genome Browser
Species Human (GRCh38)
Location X:74850421-74850443
Sequence GCAACAATGTTAGTTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192840558_1192840566 18 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC No data
Right 1192840566 X:74850462-74850484 GGCCCAATGACAGGTATGCTAGG No data
1192840558_1192840560 -3 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC No data
Right 1192840560 X:74850441-74850463 TGCCAGCCTATGTTGCCCTGAGG No data
1192840558_1192840563 9 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC No data
Right 1192840563 X:74850453-74850475 TTGCCCTGAGGCCCAATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192840558 Original CRISPR GCAACAATGTTAGTTGGTCC TGG (reversed) Intronic