ID: 1192840558

View in Genome Browser
Species Human (GRCh38)
Location X:74850421-74850443
Sequence GCAACAATGTTAGTTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192840558_1192840566 18 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1192840566 X:74850462-74850484 GGCCCAATGACAGGTATGCTAGG 0: 1
1: 0
2: 6
3: 12
4: 89
1192840558_1192840563 9 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1192840563 X:74850453-74850475 TTGCCCTGAGGCCCAATGACAGG 0: 1
1: 0
2: 3
3: 8
4: 131
1192840558_1192840560 -3 Left 1192840558 X:74850421-74850443 CCAGGACCAACTAACATTGTTGC 0: 1
1: 0
2: 0
3: 14
4: 98
Right 1192840560 X:74850441-74850463 TGCCAGCCTATGTTGCCCTGAGG 0: 1
1: 0
2: 3
3: 23
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192840558 Original CRISPR GCAACAATGTTAGTTGGTCC TGG (reversed) Intronic
902211749 1:14909582-14909604 GCAAGAGTGTTATTTGGCCCTGG - Intronic
905084895 1:35364230-35364252 GCAGTAATGTGAGTAGGTCCTGG + Intronic
905248386 1:36630308-36630330 GAAACAATGTTGGCTGGTCCAGG - Intergenic
905964512 1:42081020-42081042 GCAGCAGTGTCAGTGGGTCCAGG + Intergenic
906762457 1:48388036-48388058 GCAGCAATTTTAGCTGGTCCTGG - Intronic
908538764 1:65103217-65103239 GCACCAACGTTAGTGGGTCCTGG + Intergenic
918255983 1:182747702-182747724 GCAACATTGAAAGTTAGTCCAGG + Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
920072451 1:203312193-203312215 GCACCAATCTTTGTTGGGCCAGG - Intergenic
920426343 1:205879617-205879639 GCATTAGTGTTAGTGGGTCCAGG + Intergenic
920556126 1:206906019-206906041 GCAACAAAATTACATGGTCCTGG + Intronic
920804122 1:209216925-209216947 GCACCAATGTTAGTGGGCCCAGG - Intergenic
1067838658 10:49658042-49658064 GCAAAAATGTTTGTTGGTGTTGG - Intronic
1070867607 10:79715867-79715889 ACAACAATGTTGGTTTGTGCAGG - Intergenic
1071928816 10:90441605-90441627 GCACTGATGTTAGTTGGTTCAGG - Intergenic
1076532287 10:131153098-131153120 GCATCAGTATTAGTGGGTCCAGG + Intronic
1079777724 11:24555027-24555049 GCATCAATGATAGTTTGGCCAGG - Intronic
1084685607 11:70693133-70693155 GCAACAATGGTGGTTGGGGCTGG - Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1090257175 11:125292971-125292993 TGAACAAGGTTAGGTGGTCCAGG - Intronic
1090541413 11:127710573-127710595 TCAAGGATGTTAGTTGGGCCAGG - Intergenic
1092313454 12:7383513-7383535 GCACCAATGTGAGTTGATCTAGG - Intronic
1093327553 12:17797045-17797067 GCATAAATCTTACTTGGTCCTGG - Intergenic
1108794485 13:54014759-54014781 GCAACTATGTGAGTGGGTGCAGG + Intergenic
1117896579 14:60493913-60493935 GGAACACTGTTAGTAGCTCCTGG + Intronic
1121720474 14:96105324-96105346 CCAACAAAGTGGGTTGGTCCGGG - Intergenic
1124425846 15:29561932-29561954 GCAATAATGTTAGGTGATCAAGG + Intronic
1126433218 15:48608986-48609008 GCAATGTTGTTAGTTGGTTCAGG + Intronic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1132869531 16:2109650-2109672 GCACCAATGTGAGCTGGTGCTGG - Exonic
1134717886 16:16365949-16365971 GCACCAATGTGAGCTGGTGCTGG + Intergenic
1134956864 16:18386210-18386232 GCACCAATGTGAGCTGGTGCTGG - Intergenic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1140423619 16:74842034-74842056 GAAACAAGGTTAGCTGGTGCTGG + Intergenic
1143891427 17:10105441-10105463 GCTACCATGTTAGATGGTACAGG + Intronic
1144311985 17:14022620-14022642 GCAACAATGTTAGTAACTCAAGG + Intergenic
1144332773 17:14238699-14238721 GCAACAATGTTAGTAACTCAAGG - Intergenic
1151536903 17:74744366-74744388 GCAACAAGGTGAGTGGCTCCGGG + Exonic
1156619498 18:38832478-38832500 GAAACAATATAAGTTTGTCCTGG - Intergenic
1156661850 18:39355502-39355524 ACCACAATTTTAGTTGGTCAGGG + Intergenic
1159128988 18:64258405-64258427 CCAACAATCTTAGTGTGTCCAGG + Intergenic
1159447702 18:68560434-68560456 GACCCAATGTGAGTTGGTCCTGG - Intergenic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1165169630 19:33882600-33882622 ACAGCCATGTTAGCTGGTCCAGG - Intergenic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
1167986506 19:53322833-53322855 GCACCAATGTTAGTGAGTCCAGG + Intergenic
928968524 2:37001818-37001840 GCAAAAATATTAGCTGGGCCTGG - Intronic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
930763224 2:55058786-55058808 GCAGCTCTGTTAGTTGCTCCTGG + Intronic
935347641 2:102123620-102123642 ACAAAAATGTTAGCTGGTCATGG + Intronic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
939533581 2:143395909-143395931 GAGACAAGGTGAGTTGGTCCTGG + Intronic
942199692 2:173558837-173558859 GCAACAATGCTTGTTGGTTTAGG + Intergenic
943093216 2:183398276-183398298 GCAACTTTGTTAGTTGCACCAGG - Intergenic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
1169015134 20:2285902-2285924 GCAGCAATGTGAGTATGTCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176876188 21:14131265-14131287 GCCCCAGTGCTAGTTGGTCCTGG - Intronic
1178549393 21:33523363-33523385 GCCACAGTGTTAGTTGCTACTGG - Intronic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
951381880 3:21994979-21995001 GCAGTGATGTTAGTGGGTCCAGG + Intronic
953191006 3:40688170-40688192 CCAACCACCTTAGTTGGTCCAGG + Intergenic
960014477 3:112871456-112871478 ACACCAATGTTAGTGGGTCCAGG + Intergenic
965971996 3:174570829-174570851 TCAGAAATGTTAGGTGGTCCTGG + Intronic
966229360 3:177634357-177634379 GAAACATTGTTAGGTGGTGCAGG + Intergenic
971733371 4:30415400-30415422 CCTACAAAGTTATTTGGTCCTGG - Intergenic
974242935 4:59274620-59274642 GCTCCAATGTTAGCTGGTCTAGG - Intergenic
978489356 4:109295298-109295320 CTAACACTTTTAGTTGGTCCAGG - Intronic
981039328 4:140208859-140208881 GCCAAAATGTTAATTGGTCATGG - Intergenic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
990745091 5:58950791-58950813 GCATCAGTGTTAGTGTGTCCAGG - Intergenic
992306084 5:75439800-75439822 GGAACAATTTTAGCTTGTCCAGG + Intronic
1000703185 5:164478296-164478318 GCAACTATGTAAGTTGGTAGAGG + Intergenic
1002772704 6:303218-303240 GGAACAATGCAAGTTCGTCCTGG - Intronic
1003821562 6:9903867-9903889 ACAACAAAGTTAGATGGTTCTGG + Intronic
1004937322 6:20520330-20520352 GTAACAATATTAGTTGTTCAAGG + Intergenic
1008975481 6:57420604-57420626 CTAACAATCTTAGCTGGTCCTGG + Intronic
1009742178 6:67759544-67759566 TCCACAATGTTAGTAGGGCCTGG + Intergenic
1015596197 6:134869851-134869873 GAAACCATGTTAGTTGGCCGGGG + Intergenic
1020617490 7:10477118-10477140 GCAACAATGTTGGCAGGTCATGG - Intergenic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1023460202 7:40387787-40387809 GGAATAATGTTAATGGGTCCAGG + Intronic
1024859512 7:53822300-53822322 GGAACAATTTTATTTGGTCATGG - Intergenic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1030868959 7:114732869-114732891 GCAACGGTGTTAGTAGGACCAGG + Intergenic
1031594782 7:123637485-123637507 GCAACAATGTTAGATGCTGTAGG - Exonic
1031821362 7:126506134-126506156 GCAACAATGTTAGATGAACCTGG - Intronic
1033355100 7:140592896-140592918 GAAATAATGCTAGGTGGTCCGGG - Intronic
1034173351 7:149080365-149080387 TGAACAATGTAAGGTGGTCCGGG - Intronic
1035626916 8:1077280-1077302 GCAACCATGTTGGGAGGTCCTGG + Intergenic
1036202958 8:6784550-6784572 GAAACCATGTTAGATGCTCCTGG + Intergenic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1041507664 8:58618628-58618650 GCAACAATGTGAGTAGGAGCAGG + Intronic
1044072482 8:87778947-87778969 GCATCAGTGTTAGTGAGTCCAGG - Intergenic
1044809384 8:96042087-96042109 GCAACAATTTCAATTGTTCCAGG + Intergenic
1046402133 8:113717906-113717928 GCAACAATGTTAGTAAAACCAGG - Intergenic
1046812306 8:118546215-118546237 GCTTAAATGTTAATTGGTCCAGG - Intronic
1049113290 8:140663623-140663645 GCAAAAATGATAGTTGTTGCTGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050607151 9:7314234-7314256 GCAATGGTGTTAGTGGGTCCAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1192840558 X:74850421-74850443 GCAACAATGTTAGTTGGTCCTGG - Intronic
1195736637 X:108018957-108018979 GCACCACTGTTAGTGTGTCCAGG + Intergenic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1196976057 X:121158869-121158891 GCAACCAAGTTTGATGGTCCAGG - Intergenic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic
1197504564 X:127285708-127285730 GCAAGAATGTCAGTTGGCCATGG + Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1200743229 Y:6877702-6877724 GCACCAATGTTACTGGGTCCTGG - Intergenic
1202042443 Y:20699342-20699364 GCACTAATGTTAGTGGGTCTAGG + Intergenic