ID: 1192840558 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:74850421-74850443 |
Sequence | GCAACAATGTTAGTTGGTCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1192840558_1192840566 | 18 | Left | 1192840558 | X:74850421-74850443 | CCAGGACCAACTAACATTGTTGC | No data | ||
Right | 1192840566 | X:74850462-74850484 | GGCCCAATGACAGGTATGCTAGG | No data | ||||
1192840558_1192840560 | -3 | Left | 1192840558 | X:74850421-74850443 | CCAGGACCAACTAACATTGTTGC | No data | ||
Right | 1192840560 | X:74850441-74850463 | TGCCAGCCTATGTTGCCCTGAGG | No data | ||||
1192840558_1192840563 | 9 | Left | 1192840558 | X:74850421-74850443 | CCAGGACCAACTAACATTGTTGC | No data | ||
Right | 1192840563 | X:74850453-74850475 | TTGCCCTGAGGCCCAATGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1192840558 | Original CRISPR | GCAACAATGTTAGTTGGTCC TGG (reversed) | Intronic | ||