ID: 1192845325

View in Genome Browser
Species Human (GRCh38)
Location X:74901318-74901340
Sequence TCTCCTAGGTTGTTTCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192845325 Original CRISPR TCTCCTAGGTTGTTTCCTGG AGG Intronic
900956469 1:5889130-5889152 TCTTCTAGTTGATTTCCTGGGGG - Intronic
902210892 1:14903589-14903611 TCTGCTTTGTTGTTTCCTTGTGG + Intronic
903042568 1:20542433-20542455 TCTCCTTGGTAGTTTTCTGGTGG - Intergenic
903788502 1:25876381-25876403 TCTCCTAGGCTGTCTCCTCTTGG - Intergenic
903892364 1:26578214-26578236 TGTCCTAGTTGGCTTCCTGGAGG - Intergenic
904765360 1:32841820-32841842 TCTCCTATGTTTTTTTCTAGAGG + Intronic
907029686 1:51158201-51158223 TCTCGTAGGTTGTGTCATAGAGG + Intergenic
908012597 1:59795549-59795571 TCTCCTATGTTTTTTTCTGGTGG - Intergenic
908381469 1:63600990-63601012 CCTCCTAGGTTATATACTGGGGG + Intronic
909766193 1:79359056-79359078 TCTCCCAGGTAGTTTCCTCAGGG + Intergenic
915700924 1:157795913-157795935 TCTCCTAGGTAGTTTCTTCAGGG + Exonic
919842538 1:201619711-201619733 TCTCCCAGTCTGTGTCCTGGTGG + Intergenic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
921134222 1:212245646-212245668 TCTTCCAGGTGGTTTCTTGGGGG + Intergenic
923123390 1:231014672-231014694 TCTCTTAGGCTGTGCCCTGGAGG + Intergenic
924106928 1:240658405-240658427 TCTCCTAGATCGCTTACTGGGGG - Intergenic
1063431013 10:5988205-5988227 TCTCCCAGGTTCTTACCAGGAGG - Intergenic
1063643255 10:7852806-7852828 TCTACTATTTGGTTTCCTGGTGG + Intronic
1063676535 10:8145514-8145536 ACTTCTAGGTTCTTTCCTGTTGG + Intergenic
1064893314 10:20205213-20205235 TCTCTTAGTATGTTCCCTGGGGG + Intronic
1064897465 10:20254263-20254285 TCTTCTGGCTTGTTTCCTGGTGG - Intronic
1068180529 10:53512598-53512620 ACTCCTACCTTGTTTCATGGAGG + Intergenic
1068303763 10:55177818-55177840 TCTCCAAGGTAGTTTCTTTGAGG - Intronic
1068737976 10:60436316-60436338 ACTCCTAGGTATTTTCCTGAGGG - Intronic
1070620300 10:78004494-78004516 TGTCCTTGTTTGTTTCCTGAGGG - Intronic
1072478105 10:95783068-95783090 TCTCCTAGGGAGTTTCTTTGAGG + Intronic
1074156251 10:110802476-110802498 TCTCCTGGATTCTTCCCTGGGGG + Intronic
1075602462 10:123780396-123780418 ACTCCTAAGTTGCTTCCTGCAGG - Intronic
1076112722 10:127873216-127873238 TCTCCTTGGTTGTGGCATGGTGG + Intergenic
1079659411 11:23020431-23020453 TCACCTAGGGTTTCTCCTGGAGG + Intergenic
1080183749 11:29454626-29454648 TCTCTTTGTCTGTTTCCTGGTGG - Intergenic
1083147088 11:60767753-60767775 TCTCCTAGGTGGGGGCCTGGAGG + Intronic
1083191783 11:61057308-61057330 ACTCCTCGCTTGTTTCATGGAGG - Intergenic
1084631909 11:70357960-70357982 TTTCCTAGCATGTTTCCAGGAGG - Intronic
1086091298 11:83007781-83007803 ACTCCTGCTTTGTTTCCTGGGGG + Intronic
1086313555 11:85564348-85564370 TCTCCTATGTTTTCTTCTGGAGG + Intronic
1088003249 11:104908146-104908168 TCTCCAAGGTTGTCTCCTTCTGG + Intergenic
1088494892 11:110422894-110422916 TCCTCTAAGTTGTTTCCTGGTGG - Intergenic
1089640023 11:119841856-119841878 TCTCAGAGTCTGTTTCCTGGGGG - Intergenic
1091416912 12:295762-295784 CTTCCGAGGTTGTTTCCTTGGGG + Exonic
1091674970 12:2482508-2482530 CTTCCTAGGTTGTTGCCGGGAGG + Intronic
1091741268 12:2961600-2961622 GCTCTCAGGCTGTTTCCTGGTGG + Intronic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1098779540 12:74668843-74668865 TTTCTCAGGTTGCTTCCTGGGGG - Intergenic
1099407478 12:82281851-82281873 TCTACTAGGTAGTGCCCTGGTGG - Intronic
1101162416 12:101993019-101993041 TCTCCAGGATTGGTTCCTGGTGG + Intronic
1107397321 13:40031375-40031397 TTTCCGAGTCTGTTTCCTGGTGG - Intergenic
1107778642 13:43875540-43875562 TCTCCTGGGTTGCTTGCTGCAGG - Intronic
1109409090 13:61941357-61941379 TCTCCTTGGCTTTTACCTGGAGG - Intergenic
1110989483 13:82020785-82020807 TATCCTAGGTTATTTTCTAGAGG - Intergenic
1112359985 13:98708646-98708668 TCTCCCATGTCCTTTCCTGGTGG - Intronic
1118720173 14:68588347-68588369 TCTCCTAGGTAGTTGCCTTGGGG - Intronic
1118845408 14:69544260-69544282 TCTCCTAAGTGGTCTCCTTGTGG + Intergenic
1122362056 14:101173390-101173412 TTTCCTTGTCTGTTTCCTGGAGG + Intergenic
1122998612 14:105279586-105279608 TCTCCTACACTGCTTCCTGGTGG + Intronic
1124414797 15:29466377-29466399 TCTCCTGGGCTCTCTCCTGGGGG - Intronic
1125931188 15:43601178-43601200 TCTCCTACCTCTTTTCCTGGAGG - Intronic
1125944347 15:43700996-43701018 TCTCCTACCTCTTTTCCTGGAGG - Intergenic
1126329258 15:47514196-47514218 TCCTCTATGTTTTTTCCTGGGGG + Intronic
1130735733 15:86546729-86546751 TTTCCTATGTGGTTTCATGGAGG - Intronic
1132211516 15:100026811-100026833 ACTCCTAGATTGTTTCAAGGTGG - Intronic
1132540325 16:505445-505467 CCTCCCAGGTTGTTCCCTTGGGG + Intronic
1134127391 16:11625653-11625675 TCCCCTAGGTTGTGTGCTGAAGG + Intronic
1137616677 16:49852617-49852639 TCCCCTTTTTTGTTTCCTGGTGG - Intronic
1137668423 16:50265574-50265596 TTTCCTAGGTTATATCCTTGAGG - Intronic
1138404167 16:56775560-56775582 TCTCCTCAGTAGTTTGCTGGAGG + Intronic
1139181429 16:64752793-64752815 TCTCCAAGGATATTTCTTGGTGG + Intergenic
1141399117 16:83731718-83731740 TTTCCTAGGTTTTTTCCAGCTGG + Intronic
1141493449 16:84390438-84390460 TCTTCTAGGCCGTTTCCTTGGGG + Intronic
1143022319 17:3923201-3923223 TCTCCCAGGCTGTTTCCTCAGGG + Intergenic
1147867787 17:43564945-43564967 TCACATAGGGTGTTTCCTGGAGG + Intronic
1149115130 17:53084726-53084748 TCAACTGGGTGGTTTCCTGGAGG + Intergenic
1149227398 17:54490045-54490067 TCTCCTACATTTTTTTCTGGTGG - Intergenic
1152011176 17:77719189-77719211 TCTCCCAGCTTATTTCCTGGAGG - Intergenic
1158379366 18:56912193-56912215 TCTGATTGGTTGATTCCTGGAGG + Intronic
1160298352 18:77657687-77657709 CCTCCTGAGTGGTTTCCTGGGGG - Intergenic
1162433136 19:10641428-10641450 TGTCGTAGGTGGTTTCCTGGAGG + Intronic
1167001539 19:46748067-46748089 CCTCCTAGGTTGTAGGCTGGGGG - Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
928131815 2:28657275-28657297 TCTACTAGGTTGTTTTCAAGTGG - Intergenic
929879489 2:45823659-45823681 TCTCCTAGGATGCCTACTGGTGG - Intronic
932563007 2:72888687-72888709 TCCTGTGGGTTGTTTCCTGGAGG - Intronic
939359456 2:141149773-141149795 TTTCCTTTGTTCTTTCCTGGAGG - Intronic
942444414 2:176068507-176068529 TCTCCCAGGATGCTTCCTGGTGG + Intergenic
944083850 2:195821363-195821385 TTTCATCTGTTGTTTCCTGGTGG + Intronic
948315509 2:237025610-237025632 TCTGCTAGGTAGTTTCATGTGGG + Intergenic
948526250 2:238572634-238572656 TCACCAAGGTACTTTCCTGGTGG - Intergenic
948782804 2:240333771-240333793 TCCCCAAAGGTGTTTCCTGGAGG - Intergenic
949080833 2:242098122-242098144 TCTTCTATCTTGTTTCCTTGGGG - Intergenic
1169210586 20:3764291-3764313 TCTCCCAGGATGCTTCCTGAAGG + Intronic
1170398359 20:15952657-15952679 CCTCCCAGATTCTTTCCTGGGGG + Intronic
1170878580 20:20274016-20274038 TCTACTAGGCTTTTTTCTGGAGG + Intronic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1172994335 20:39058910-39058932 TCTCTTACGTTCCTTCCTGGGGG + Intergenic
1175754965 20:61523635-61523657 TCTCCCAGCTACTTTCCTGGGGG + Intronic
1178037757 21:28603702-28603724 TTTCCTGGGTTGTTTTCTGAAGG + Intergenic
1181951414 22:26556599-26556621 TCACCTATGTTGTCACCTGGAGG + Intronic
1183910877 22:41078161-41078183 GCTCCTAGGCTGTCTCCTAGAGG + Intergenic
1184258346 22:43300123-43300145 TCTCCTGGGTGGATACCTGGGGG + Intronic
949293127 3:2488487-2488509 TCTCCAGGGTTGGTTCCTGCTGG + Intronic
949758763 3:7444816-7444838 TCAACTAGGATGCTTCCTGGGGG - Intronic
950045907 3:9948603-9948625 TATCCTAGGTTGTTTGAAGGAGG + Intronic
950874445 3:16257350-16257372 TCACCTGGTTTGTTTCCTTGGGG + Intergenic
950954698 3:17039697-17039719 TCTCCTAGGCTGGTTCCTTCTGG + Intronic
951619693 3:24587534-24587556 TCCTCTGGGTAGTTTCCTGGTGG - Intergenic
953569623 3:44060972-44060994 TCTACTAGCGTGTTTCTTGGGGG - Intergenic
954692266 3:52401873-52401895 TCTCCTAGGAGCTGTCCTGGTGG - Exonic
955151922 3:56375944-56375966 TCTCATGGGCTGTTACCTGGAGG - Intronic
956199832 3:66694674-66694696 TTTCCTAGTTTTATTCCTGGAGG - Intergenic
960204342 3:114876811-114876833 TATCATAGGTGGTTTCTTGGAGG - Intronic
961862490 3:129927743-129927765 TCTCCTCTGTCGTGTCCTGGCGG - Intergenic
967039652 3:185679265-185679287 TCTCATAGATTTTTTCTTGGTGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
970302710 4:14698206-14698228 TTTCTCAGGTTGTTTCCTTGTGG - Intergenic
970551290 4:17184368-17184390 TCCCTTAGCTTATTTCCTGGTGG + Intergenic
970962273 4:21886387-21886409 TCTCCCAGGCTGTTTTCTGAAGG + Intronic
976067860 4:81210126-81210148 TCTCCTATGTTGTCTTTTGGGGG - Intronic
976672640 4:87670963-87670985 TCTTCTTGGTTGTTTCATGAGGG + Intergenic
977137162 4:93319727-93319749 TCTCCTAGCGCCTTTCCTGGAGG - Intronic
977479602 4:97558578-97558600 TCTCCTTGGCTGTTGGCTGGAGG - Intronic
978280967 4:107013584-107013606 TCTCCTGCATTTTTTCCTGGTGG - Intronic
979236859 4:118410111-118410133 TCTCCTAGACTGATTGCTGGAGG + Intergenic
980578995 4:134724438-134724460 TCTCTTAGATTATTTTCTGGAGG - Intergenic
982429855 4:155310448-155310470 TGTCCTAGTCTGTTTTCTGGTGG - Intergenic
985373608 4:189311405-189311427 TGTCCTAGCTTGCTGCCTGGTGG + Intergenic
986110177 5:4708603-4708625 TCCTCTAGGTTGTAACCTGGAGG - Intergenic
986501744 5:8408167-8408189 TCTCCGTGGTTGTTTCCTGCAGG + Intergenic
986876726 5:12120161-12120183 TATCCTAGACTGTTTTCTGGGGG + Intergenic
988056512 5:26104756-26104778 GCTCCTAGATTTTTTCTTGGTGG + Intergenic
988503223 5:31800402-31800424 TGTCCAAGGTTTTTTCTTGGGGG + Intronic
988603915 5:32664302-32664324 TCTCTGAGGGTGTTTCCTTGAGG + Intergenic
988606151 5:32680011-32680033 TCTCAGAGTATGTTTCCTGGAGG + Intergenic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
990334882 5:54762806-54762828 TCTCCTAGATTATATACTGGTGG - Intergenic
990530933 5:56672884-56672906 TCTCCTAGTTGATTTCCTTGAGG - Intergenic
992766994 5:80010602-80010624 TCTCAGAGTCTGTTTCCTGGGGG - Intronic
999249217 5:150172103-150172125 TCTCCGAGGCTGTCTCCTGTAGG + Intronic
999455275 5:151710393-151710415 TCTACTATTTTGTGTCCTGGTGG - Intergenic
1000159711 5:158585785-158585807 TCTCCAGGATTGGTTCCTGGTGG + Intergenic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1001550596 5:172599514-172599536 TCTCCTGGGTTTGTACCTGGAGG - Intergenic
1004496000 6:16163543-16163565 TTTTCTAGGTTCTTTCCTGCTGG + Intergenic
1005348479 6:24911977-24911999 TCTCCTAGGATGTTCCCTTTCGG - Intronic
1005509360 6:26498341-26498363 TCTCCTTGCTTCTTTCCTGAGGG - Intergenic
1007314418 6:40974362-40974384 TTTCCTAGGTTGTCTTCTAGGGG + Intergenic
1012714427 6:102650042-102650064 TCTCCTGGATTGGTCCCTGGTGG - Intergenic
1013051919 6:106544384-106544406 TCTCTTAGGTTATTTTCTTGGGG + Intronic
1016896569 6:149059788-149059810 GCTTCTAGGTTATTGCCTGGGGG - Intronic
1018578171 6:165281882-165281904 TCTCCTAGTTTTTTACCGGGAGG - Intronic
1018603009 6:165565976-165565998 TCTCCTATGTTATTTTCTAGGGG - Intronic
1020382941 7:7566460-7566482 TCTCCTTGCCTGTTTCCTGCCGG + Intergenic
1020625285 7:10570491-10570513 TCTACCAGGGTGTTTCCTGCAGG - Intergenic
1020671069 7:11113092-11113114 TTTCCTAACTTGTTTGCTGGGGG - Intronic
1021522444 7:21551301-21551323 TCTGCAAGCTTGTTTCCTGTAGG + Intronic
1026342855 7:69449039-69449061 TCTCCAAAGCTGTTTTCTGGGGG - Intergenic
1026737738 7:72959870-72959892 TCTCCAAGGTTATTACCTGGAGG + Exonic
1026788773 7:73318671-73318693 TCTCCAAGGTTATTACCTGGAGG + Exonic
1027105996 7:75405198-75405220 TCTCCAAGGTTATTACCTGGAGG - Exonic
1028364618 7:90012999-90013021 TCCCTTAGGTTGTTTTCTGCTGG - Intergenic
1030899154 7:115100904-115100926 GCTCTAAGGTTGTTTCCTTGTGG - Intergenic
1031225224 7:119028396-119028418 TCTCCTATGTTATTTTCTAGTGG - Intergenic
1035941760 8:3909308-3909330 TCTCCTAGGGTGATTCGTGTGGG + Intronic
1037662979 8:20943040-20943062 ACTCCTAGTTTGTTTCCTCTTGG - Intergenic
1038178019 8:25198902-25198924 TCTCCTGGGTTTTTTCCAGGTGG + Intronic
1040662562 8:49592989-49593011 TCTCCTAGGTTTTCTCCAAGTGG + Intergenic
1040856509 8:51954027-51954049 TCTCCAAGGTGGTTTCATTGGGG - Intergenic
1041948638 8:63475341-63475363 TCTCCTTGCATCTTTCCTGGTGG - Intergenic
1042010021 8:64233705-64233727 TCTCCCCAGTTGTTCCCTGGAGG - Intergenic
1042576956 8:70231541-70231563 TCTCCTAGGGTCTTTCCTCAAGG - Intronic
1043874499 8:85468969-85468991 TCTCCTTGCTAGTTTGCTGGAGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045542398 8:103099371-103099393 TCTCCTAGGCTGTTACCTCATGG - Intergenic
1045866189 8:106868268-106868290 TCTCCTAACTTGGTCCCTGGGGG - Intergenic
1046670927 8:117055321-117055343 TCTCCTTGGTTATATGCTGGTGG + Intronic
1052956248 9:34255212-34255234 TCTCCTGGGTAGCTTTCTGGAGG + Intronic
1053142902 9:35692065-35692087 TCCCCTTGGCTGATTCCTGGTGG + Intergenic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054174421 9:61865078-61865100 TCTTCTAGCTGGTTTCCTAGAGG + Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054663117 9:67715713-67715735 TCTTCTAGCTGGTTTCCTAGAGG - Intergenic
1054789110 9:69238504-69238526 TCTCCTAGAATGCTTCCTGTTGG + Intronic
1057217377 9:93236565-93236587 TCTGCTAGGTTGTTTTGTGTTGG - Intronic
1058505707 9:105663734-105663756 TCTCCCAGGTTGGTTTCTGCAGG - Intergenic
1061393579 9:130331307-130331329 TCTCCTGGGTCGGTTCCTTGCGG + Intronic
1185615996 X:1422446-1422468 TCTCCTAGGTTATATCCTAGGGG + Intronic
1186354380 X:8774515-8774537 TCTCCTAGGTAATATCCTGAAGG - Intergenic
1186731199 X:12411948-12411970 TCTTCCAGGTTTTTTCCTAGGGG - Intronic
1188181085 X:27056853-27056875 TATCCCAGCTTGTTTTCTGGAGG - Intergenic
1188725746 X:33579738-33579760 TCTCCTACGTTCTTCTCTGGTGG + Intergenic
1190000881 X:46685334-46685356 ACTGCCAGGGTGTTTCCTGGGGG + Intronic
1190455218 X:50620469-50620491 CCTCTTAGGTTATTTCCTTGGGG + Intronic
1191695016 X:63980191-63980213 TCTTCAAGGTTGCTTCCTGGTGG - Intergenic
1192845325 X:74901318-74901340 TCTCCTAGGTTGTTTCCTGGAGG + Intronic
1193088564 X:77469216-77469238 TCTCCAGGGTTGATCCCTGGTGG - Intergenic
1199374090 X:147087358-147087380 TCTCCAGGGTTGGTTTCTGGGGG + Intergenic