ID: 1192846025

View in Genome Browser
Species Human (GRCh38)
Location X:74907918-74907940
Sequence CAGCTGAGACAGCCTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192846025_1192846034 27 Left 1192846025 X:74907918-74907940 CCCACCTCAGGCTGTCTCAGCTG 0: 1
1: 0
2: 2
3: 26
4: 294
Right 1192846034 X:74907968-74907990 TGGAAACAGGCTGCTTCCCTCGG 0: 1
1: 0
2: 4
3: 35
4: 253
1192846025_1192846029 7 Left 1192846025 X:74907918-74907940 CCCACCTCAGGCTGTCTCAGCTG 0: 1
1: 0
2: 2
3: 26
4: 294
Right 1192846029 X:74907948-74907970 ACACCCTCTACCTGAGGATCTGG 0: 1
1: 0
2: 0
3: 7
4: 103
1192846025_1192846028 1 Left 1192846025 X:74907918-74907940 CCCACCTCAGGCTGTCTCAGCTG 0: 1
1: 0
2: 2
3: 26
4: 294
Right 1192846028 X:74907942-74907964 TTGAGCACACCCTCTACCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 107
1192846025_1192846032 14 Left 1192846025 X:74907918-74907940 CCCACCTCAGGCTGTCTCAGCTG 0: 1
1: 0
2: 2
3: 26
4: 294
Right 1192846032 X:74907955-74907977 CTACCTGAGGATCTGGAAACAGG 0: 1
1: 0
2: 2
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192846025 Original CRISPR CAGCTGAGACAGCCTGAGGT GGG (reversed) Intronic
900329424 1:2126661-2126683 CAGCGGCCACAGCCTGTGGTTGG + Intronic
901395831 1:8980862-8980884 CAGCTGAGAGATCCTATGGTTGG + Intergenic
902176357 1:14653826-14653848 CAGTTGAGAAAGCCTGATTTAGG - Intronic
902369603 1:15997495-15997517 GAGCTAAGACATCCTGAGCTGGG - Intergenic
902649924 1:17830319-17830341 CATCTAAGCCACCCTGAGGTAGG - Intergenic
902676169 1:18009857-18009879 CTGGTGGGAAAGCCTGAGGTTGG + Intergenic
902815122 1:18912037-18912059 CGACTGTGACAGCCTGACGTGGG - Exonic
903725152 1:25436754-25436776 CAGCTGAGACAATTTGATGTCGG - Intronic
903893179 1:26583827-26583849 AAGCTGAGAAAAGCTGAGGTGGG + Intergenic
905228665 1:36497004-36497026 CAGCTACTACAGGCTGAGGTAGG - Intergenic
905489766 1:38334259-38334281 CTGCTCAGCCAGCCTAAGGTTGG + Intergenic
906107308 1:43302496-43302518 CAGCTTACACTGCCTCAGGTAGG + Intronic
906280802 1:44552186-44552208 CATCTGAGACAGCCTAAAGGAGG - Intronic
907332439 1:53679905-53679927 CACCTGAGGCAGCCTGACCTTGG + Intronic
907434975 1:54439786-54439808 CAGCCAAGCCAGCCTGAGTTCGG + Intergenic
907887951 1:58610997-58611019 CAGCTGTGGCAGACAGAGGTGGG - Intergenic
908565416 1:65350894-65350916 CAGCAGAGACTGCCTGATGCAGG - Intronic
910888077 1:91987580-91987602 AGGCTGAGGCAGGCTGAGGTGGG - Intronic
911171271 1:94773412-94773434 ACCCTGAGACAGCCTGAGTTAGG + Intergenic
911474503 1:98359019-98359041 GAGCTGGGACAGACTAAGGTAGG + Intergenic
915107029 1:153541117-153541139 CAGCTGAGTCTCCTTGAGGTGGG - Intronic
915470890 1:156125201-156125223 GAGCTGAGACAGGCTCAAGTAGG + Intronic
915732210 1:158061728-158061750 AAGCTGAGACAGGCTCATGTGGG + Intronic
916285232 1:163098920-163098942 GAGTTGATACACCCTGAGGTAGG - Intergenic
917217297 1:172691544-172691566 GAGTTGATACACCCTGAGGTAGG + Intergenic
917353014 1:174097579-174097601 CAGTTGAGAGACCCTGAGGCAGG + Intergenic
919926163 1:202192964-202192986 CAGCTCAGCCACCCTGAGGCTGG - Intergenic
922225963 1:223646110-223646132 CAGCTGAGACAACAAGAGGGCGG + Intronic
1064594977 10:16934818-16934840 CAGCTCCAACAGCCTGAGTTAGG + Intronic
1064611563 10:17108172-17108194 CATCTGAAGCACCCTGAGGTAGG + Intronic
1065384401 10:25119924-25119946 TAGGAGAGACAGCCTGAAGTTGG + Intergenic
1065973551 10:30823712-30823734 CAGGGGAGACAGGCTGAGCTGGG - Intronic
1067281782 10:44878899-44878921 CAGCTCAGCCAGGCTGAGGCAGG - Intergenic
1067427306 10:46219969-46219991 TTTCTGAGACAGCCTGAGCTGGG + Intergenic
1067582739 10:47455854-47455876 TTTCTGAGACAGCCTGAGCTGGG + Intergenic
1069410264 10:68146204-68146226 CAATGTAGACAGCCTGAGGTGGG - Intronic
1069888524 10:71638772-71638794 CTGCTGGGACAGACTCAGGTCGG + Intronic
1069995127 10:72337150-72337172 CAGCTGACAGAGCCTGTGATTGG - Intronic
1070652523 10:78248074-78248096 GAGCTGAGACAGCCTAGGTTGGG - Intergenic
1073459357 10:103657719-103657741 CAGCTGAGAGGGTCTGAGGAAGG - Intronic
1074777176 10:116775035-116775057 CAGCAGAGACAGCCACAGGATGG - Intergenic
1081627753 11:44665725-44665747 AAGCTGAGACAGCCTTGGGAAGG + Intergenic
1081721098 11:45288947-45288969 CAGTTAAGACAGTCTGAGGCTGG + Intergenic
1082821665 11:57548110-57548132 CACCTGATAAAGCATGAGGTGGG + Intronic
1082890978 11:58138255-58138277 CAGCTGGGGCTGCCTGAGGCTGG + Intronic
1083693460 11:64426289-64426311 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1084110684 11:67012440-67012462 TAGCTCAGTCAGTCTGAGGTGGG - Intronic
1085297090 11:75437424-75437446 CAGCTGGGACTCCCTGAGATTGG - Intronic
1086305185 11:85472267-85472289 CAGTTGAGAGGACCTGAGGTGGG - Intronic
1086412153 11:86553702-86553724 CAGCTGAGTGAGCTTGAGGCAGG - Intronic
1086821664 11:91443212-91443234 CATCTGAGACAACCTCAGCTTGG + Intergenic
1086997330 11:93372921-93372943 CAGCTCAGACAGTCGGAGGTGGG - Intronic
1089335222 11:117718245-117718267 AGGCTGACACAGCCTGAGGATGG + Intronic
1090266568 11:125356876-125356898 CAGCTGTGACAGGCAGAAGTGGG + Intronic
1090333442 11:125948013-125948035 CAGCACAGCCAGCGTGAGGTGGG - Intergenic
1090854041 11:130596498-130596520 CAGTTGACACAGCCTGAGTGAGG - Intergenic
1090878914 11:130816075-130816097 CTGGTGAGAAAGCCTGAGATGGG + Intergenic
1091251036 11:134144524-134144546 GAGCTGAGACTGCCTGAGTTGGG + Intronic
1092696713 12:11179570-11179592 AAGCTGAGACAGACTGCTGTGGG - Intergenic
1096262990 12:50104486-50104508 CTGCTGTGAGATCCTGAGGTGGG + Intronic
1096548174 12:52355702-52355724 CAGGTGAGACAGCCCTAGGTAGG - Intergenic
1097480959 12:60125640-60125662 CATCTGAGACAACCTCAGCTTGG - Intergenic
1097810363 12:64012662-64012684 CAGCTATGAGAGGCTGAGGTGGG - Intronic
1098577395 12:72058695-72058717 CAGCTAAGAGAGACTGAGGGAGG - Intronic
1099840683 12:87961856-87961878 GAGGGGAGACAGCCAGAGGTTGG - Intergenic
1099860383 12:88218497-88218519 CAGTGCAGTCAGCCTGAGGTGGG - Intergenic
1101040412 12:100749833-100749855 GAGCTAAGAGAGCCTGAGTTTGG + Intronic
1101548199 12:105736654-105736676 CAGCTGGGAAAGCCAGAGGGAGG + Intergenic
1102131361 12:110531649-110531671 CTGCCAAGACAGCCTGAGTTTGG + Exonic
1104091441 12:125521080-125521102 CAGCTAGGTCAGGCTGAGGTTGG + Intronic
1106028029 13:25973753-25973775 TCGCTGAGCCAGCCTGAGGCAGG + Intronic
1106758486 13:32845334-32845356 CAGGTGATACAGCTTGAGCTGGG - Intergenic
1107554487 13:41505599-41505621 CATCTGATACAGGCTGAGCTTGG - Intergenic
1107757080 13:43636089-43636111 CACCTCAGGCTGCCTGAGGTTGG + Intronic
1107964432 13:45586606-45586628 CCACTGAGACTGTCTGAGGTGGG + Intronic
1108302558 13:49093122-49093144 CAGTTGAGAAAGGCTGATGTGGG - Intronic
1110033729 13:70653228-70653250 CATCTGAGACATCCTTAGCTTGG - Intergenic
1110601988 13:77386128-77386150 GAGCTGAGAAACCCTGAGCTAGG - Intergenic
1113249110 13:108431603-108431625 CAGCTGTGGGAGCCCGAGGTTGG - Intergenic
1113320737 13:109229685-109229707 CAGCTGAGACTGCCTCAGCCTGG + Intergenic
1117551647 14:56843108-56843130 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1118454447 14:65931887-65931909 CAGCTGAGAGAGACTGAGGAAGG + Intergenic
1119128321 14:72149024-72149046 CAGCTGGGGGAGCCTGAGGCTGG + Intronic
1119457536 14:74769382-74769404 TAGCTGAGGCAGGCTGAGGCAGG - Intronic
1120864602 14:89284984-89285006 CAGGTCGGACAGCCTGAGGGTGG + Intronic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1122896356 14:104759408-104759430 CAGCTGCGACAGCGTCAGGGAGG - Exonic
1123986584 15:25651700-25651722 CAGCTGAGGGAGGCTGAGGCAGG - Intergenic
1124581572 15:30960279-30960301 CAGCCCAGCCAGCCTGAGATGGG + Intronic
1126544777 15:49861497-49861519 ATGCTGAGAGAGACTGAGGTAGG - Intronic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1129034633 15:72641840-72641862 GGGCTGGGCCAGCCTGAGGTTGG - Intergenic
1129215249 15:74095376-74095398 GGGCTGGGCCAGCCTGAGGTTGG + Intergenic
1129321657 15:74778339-74778361 CATCTCAGCCAGGCTGAGGTGGG - Intergenic
1131092477 15:89633034-89633056 CGGCTGACACAGCCAGAGGTGGG - Intronic
1131616710 15:94023922-94023944 CAGCTGAGGCTACCTAAGGTCGG - Intergenic
1132467227 16:82947-82969 CGGCTGACACACCCTGAGCTGGG + Intronic
1132993726 16:2811815-2811837 AAGCTGAGACACCCTGCTGTGGG - Intergenic
1133331842 16:4979769-4979791 CAGCAGACAGAACCTGAGGTTGG + Intronic
1133722313 16:8506592-8506614 CAGGAGTGACACCCTGAGGTTGG + Intergenic
1135209018 16:20508118-20508140 CATCTGAGACCGCCTCAGCTTGG + Intergenic
1136172175 16:28495967-28495989 AGGCTGAGACAGCCTCAGGCGGG + Exonic
1138180560 16:54937835-54937857 CGGCTGAAACAGCCTGCGGGTGG + Intergenic
1139210967 16:65076380-65076402 CAGCTCAGTGAGCCTGAGGGAGG - Intronic
1139504748 16:67393270-67393292 CGGCTGGGACCGCCGGAGGTTGG + Intronic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1142356692 16:89604726-89604748 CAGCTGTGGCTGCCTGAGGAAGG - Intergenic
1143020973 17:3917060-3917082 CAGCCGAGAGAGCCTGACCTCGG + Intergenic
1144284114 17:13756090-13756112 CAGCTGAAAGTGGCTGAGGTTGG - Intergenic
1144330666 17:14221215-14221237 GAGCAGAGACAGCCTAAGGAGGG + Intergenic
1144512106 17:15886294-15886316 CAGGCAGGACAGCCTGAGGTTGG - Intergenic
1144670524 17:17130270-17130292 CTTCTGAGACAGCCTCAGGATGG - Intronic
1145248953 17:21287045-21287067 CAGCTGTGACAGGCGGAGCTAGG + Intronic
1146515297 17:33484638-33484660 CAGCTCAGACCAACTGAGGTAGG + Intronic
1147439161 17:40436874-40436896 GAGCAGAGAGAGCCAGAGGTTGG - Intergenic
1148272102 17:46269418-46269440 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1150983427 17:70169267-70169289 CAGCTGGGACAGCAGCAGGTGGG - Intronic
1151485002 17:74393523-74393545 CAGCTGAGTCAGCCAGACTTTGG - Intergenic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1151821284 17:76498251-76498273 CAGCTGAGCCAGGCTGGGGGAGG - Intronic
1152106227 17:78330749-78330771 CAGCACAGCCATCCTGAGGTGGG - Intergenic
1152149437 17:78589797-78589819 CAGCAGAGTCTGCCTGAAGTTGG + Intergenic
1152278111 17:79369750-79369772 CTGCAGAGAGAGCCTGAGCTGGG - Intronic
1152344597 17:79743311-79743333 CAGGTGGGGCAGGCTGAGGTGGG - Intergenic
1153995859 18:10440891-10440913 CAGTTGAGACAGACTGTGGATGG - Intergenic
1156113421 18:33756381-33756403 CAGCTGTGAGAGCATGACGTTGG + Intergenic
1156269907 18:35521058-35521080 CAGGAGAGATAGCCTGAGATTGG - Intergenic
1156384735 18:36594861-36594883 CAGCAGTGACAGCCTGAATTAGG - Exonic
1157010259 18:43639778-43639800 CAGCTCAGTCATTCTGAGGTAGG - Intergenic
1157830150 18:50850167-50850189 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1160125626 18:76169179-76169201 CAGGAAAGACAGCCAGAGGTGGG + Intergenic
1160139523 18:76309234-76309256 CAGATCAGGCACCCTGAGGTGGG - Intergenic
1160482768 18:79257653-79257675 CAGCAGAGACGGCCTGTGGCTGG + Intronic
1160560860 18:79755038-79755060 CAGCGGAGACAGCCTGAGCCTGG - Exonic
1161164453 19:2778602-2778624 CAGCTTAGACACCCTGGGCTAGG + Intronic
1161286754 19:3472292-3472314 CAGCTGAGACCCCCTGACCTTGG - Intergenic
1161604698 19:5208148-5208170 CAGATGGGACAGCCTAAGCTTGG + Intronic
1161843736 19:6697893-6697915 CAGCAAAGACAGGCTGAGTTAGG - Intronic
1162791836 19:13066988-13067010 AATCTGAGACACCCTGAGGAGGG - Intronic
1163160326 19:15460362-15460384 CTGCTAATACAGCCTGAGCTTGG - Intronic
1163546417 19:17943609-17943631 CAGCTGCGACAGCCGCATGTTGG - Exonic
1165143762 19:33718785-33718807 CAGCTCAGCCAGCATGAGGCTGG + Intronic
1165364702 19:35358413-35358435 CAGCTGAGACTGCATGAGGAGGG + Intergenic
1166324360 19:42040196-42040218 CAGCTGAGAGTGTCTGTGGTTGG - Intronic
925735209 2:6957964-6957986 CAGCTGAGACTGCCTAATCTTGG + Intronic
927341060 2:21983373-21983395 CATCTGAGACCACCTCAGGTTGG + Intergenic
927826476 2:26313129-26313151 CAGACGAGACAGCATGAAGTGGG + Intronic
928172620 2:29013046-29013068 CAGCTGAGGCTGCCTGAGGCTGG - Intronic
928398379 2:30960615-30960637 CAGCTGGGAGGGCCTGAGGTGGG + Intronic
928551854 2:32380478-32380500 CAGCTGAGGGAGGCTGAGGCGGG + Intronic
932603201 2:73144481-73144503 AAGCTGAGACAACCTGGAGTTGG + Intronic
932652407 2:73572708-73572730 CAACAGAGACAGCCTGAGTTGGG + Exonic
934704981 2:96470917-96470939 CAGCGGTGCCAGCCTGAGGCAGG + Intergenic
935617408 2:105101012-105101034 CAGCTGAGACTTCCTGGGGAAGG - Intergenic
935644539 2:105323287-105323309 AAGCTGACAAAGCCAGAGGTGGG - Intronic
936400806 2:112163143-112163165 CAGCCGTGGCAGCCTGAGCTGGG - Intronic
937206621 2:120240797-120240819 CTGCTGAGTCAGTGTGAGGTTGG + Intronic
937325937 2:120989584-120989606 CAGCTGCGACAGCCAGTGGCAGG + Exonic
940887084 2:158999526-158999548 CAGCTGACACTGGCTTAGGTAGG - Intronic
942192419 2:173483282-173483304 CAGCTGATCTAGCCTGAGGCTGG + Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946664085 2:222031257-222031279 CAGGTGAGAAAGCCTGAGAAAGG + Intergenic
947247851 2:228069934-228069956 CAGCTGGGACACAGTGAGGTGGG - Intronic
948338642 2:237231338-237231360 CAGCTGAGACAGCCTGAGCAGGG - Intergenic
948983670 2:241507853-241507875 CAGCGGAGCCGTCCTGAGGTGGG - Intronic
949036697 2:241818741-241818763 GGGCTGAGGCTGCCTGAGGTGGG - Intergenic
1168825444 20:810207-810229 AAGGTGAGACAACCTGAAGTGGG - Intergenic
1172421777 20:34824918-34824940 CAGCCCTGACAGCCTGAGCTTGG + Intronic
1173486701 20:43446420-43446442 CAGATGAGACAGGCCCAGGTGGG - Intergenic
1173551032 20:43933361-43933383 CAGCTGCGCTGGCCTGAGGTAGG - Intronic
1173562976 20:44019521-44019543 CAGCTGAGACAGGGTTAGGAGGG + Intronic
1173726794 20:45304081-45304103 AATCTGACACAGCCTGCGGTAGG + Intronic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1176424518 21:6539916-6539938 CTGCTGGGCCAGCCTCAGGTCGG + Intergenic
1178620119 21:34166876-34166898 CAGCAGGGAGAGCCTGAGCTTGG - Intergenic
1179700011 21:43148231-43148253 CTGCTGGGCCAGCCTCAGGTCGG + Intergenic
1180025489 21:45158860-45158882 CTGCAGAGACAGCTTGTGGTGGG + Intronic
1181854369 22:25771630-25771652 CGGGAGAGAAAGCCTGAGGTGGG - Intronic
1182007856 22:26976078-26976100 GAGCTCAGAGAGCCTGTGGTGGG + Intergenic
1182041103 22:27239566-27239588 CATCAGAGACAACCTGAGCTTGG + Intergenic
1182268650 22:29138763-29138785 TACCTGGGACAGTCTGAGGTGGG - Exonic
1182619616 22:31611704-31611726 CAGCCTAGACAGCCTGGGGTGGG - Intronic
1183206560 22:36423497-36423519 GAGCTGAGACACCCGGTGGTGGG + Intergenic
1184461274 22:44639551-44639573 CAGCTGGGACAGCCCGGGGAAGG + Intergenic
1184775390 22:46620548-46620570 TATCTGAGACAGACGGAGGTAGG + Exonic
1185024794 22:48402764-48402786 CAGCCCACACAGCCTGACGTGGG + Intergenic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
950125387 3:10506967-10506989 CAGTTGGGAGCGCCTGAGGTGGG + Intronic
951531959 3:23706250-23706272 CAGCTGTGACAGTCTGTGGCAGG - Intergenic
952883941 3:38001591-38001613 CAGGTGTGCCAGCCTGAGGGAGG + Exonic
953607422 3:44420841-44420863 CTTTTGAGACAGCCTGAGGCTGG - Intergenic
953891413 3:46754282-46754304 CAACTGACACAGCCTGGAGTGGG - Intronic
953896897 3:46809950-46809972 CAGCTGACACAGCCTGGAGTGGG - Intronic
955986217 3:64576631-64576653 GAGCTGAGAGCGCCTGAGATTGG + Intronic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
959184829 3:103033170-103033192 AAGCTGAGACACCATCAGGTGGG - Intergenic
960041213 3:113151602-113151624 CTGCTGAGCCAGGCTGGGGTAGG + Intergenic
961021970 3:123515483-123515505 CAGCTGGAACAGCCTTGGGTGGG + Intronic
961644674 3:128386464-128386486 CAGCTGAGACAGGCAGTGGGGGG + Intronic
961813267 3:129533886-129533908 CACCTGGGACAGCCTGAGAAGGG + Exonic
962285371 3:134081418-134081440 CAGCTGAGAAACACTGAGCTTGG - Intronic
963042045 3:141077229-141077251 AAGCCGAGACAGCGTGAGCTTGG + Intronic
963322354 3:143822572-143822594 TAACAGATACAGCCTGAGGTAGG - Intronic
963490265 3:145991311-145991333 CAGCTGAGTCAACCTGAGTAAGG - Intergenic
964570192 3:158102623-158102645 GAGCAGAGAGAGCCTGGGGTTGG - Intronic
965124914 3:164613907-164613929 CAGCTGAAACAGCTTTAGGATGG + Intergenic
965183417 3:165433955-165433977 CATCTGAGACCGCCTCAGGCTGG - Intergenic
966633002 3:182099218-182099240 CAACTCAGAAAGTCTGAGGTAGG - Intergenic
968148369 3:196318365-196318387 CGGCTGATACTGCCTGAGGCGGG - Intronic
970351593 4:15206981-15207003 CATCTGAGACAGCCTGAACCTGG - Intergenic
972338420 4:38129147-38129169 CAGCTGAGAAACCCTGCTGTGGG + Intronic
972984058 4:44742120-44742142 CAGCTGAGAAATGCTGAGCTTGG + Intergenic
974872411 4:67659864-67659886 CATCTGAGACCGCCTCAGGCTGG - Intronic
977030388 4:91875710-91875732 CATCTGAGACAGCCTCAGTCTGG - Intergenic
977120143 4:93089949-93089971 CAGCTGAGAAACCCTGAGCTTGG + Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
979518799 4:121642349-121642371 CAGCTGAGAAACACTGAGTTTGG + Intergenic
979615140 4:122733654-122733676 CAGGGGAGAAAGACTGAGGTAGG + Intronic
980850488 4:138374933-138374955 CATCTGAGACAACCTCAGGCTGG + Intergenic
981120656 4:141047367-141047389 CAGCTGAGACAGGCAGAGGCTGG + Intronic
982607724 4:157536199-157536221 CATCTGAGACATCCTGAGCCTGG - Intergenic
983470075 4:168144809-168144831 CAACTAGGACACCCTGAGGTTGG + Intronic
987066049 5:14290855-14290877 CAGCCGAGACAGCATGTGGGTGG - Exonic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989729852 5:44635923-44635945 GAGTTGAGGCAACCTGAGGTGGG + Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991179182 5:63728927-63728949 CAGCTGAGACAGACAGAAGCAGG + Intergenic
992907222 5:81358386-81358408 CTGCTGAGGCACCCTGAGGCAGG - Intronic
993099458 5:83519536-83519558 TATCTGTGATAGCCTGAGGTTGG - Exonic
993264663 5:85709551-85709573 CAGCTGGGAAACCCTTAGGTGGG + Intergenic
993520824 5:88897940-88897962 CAGCTAAGTGGGCCTGAGGTGGG - Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995396625 5:111693875-111693897 CAGCTGAGAGAGGCTGAGGCAGG + Intronic
995683863 5:114749819-114749841 CAGCTGAGATGGCCAGAAGTGGG + Intergenic
997052317 5:130397859-130397881 CATCTGAGACTGCCTCAGCTTGG - Intergenic
999144026 5:149380980-149381002 GGGCTGGGACAGCCTGCGGTGGG - Intronic
1000575336 5:162969136-162969158 CATCTGAGACCTCCTCAGGTTGG - Intergenic
1001522967 5:172408058-172408080 CAGGTGAGTCAGCCTCAGCTTGG + Intronic
1003045928 6:2732668-2732690 GAGCTGAGAGAGCCTGAGGAGGG + Intronic
1006093070 6:31639572-31639594 CAGCTAAGGCAGCCGGAGCTCGG - Exonic
1006154524 6:32007082-32007104 CAGCTGAGGCAGCACAAGGTGGG + Intergenic
1006160835 6:32039818-32039840 CAGCTGAGGCAGCACAAGGTGGG + Exonic
1006375449 6:33669240-33669262 GAGCTCTGACAGCCTCAGGTGGG + Intronic
1007394215 6:41568331-41568353 CAGATGAGACAGCCAGAGGTAGG + Intronic
1011117228 6:83906567-83906589 GAGCTGAGAAAGACTCAGGTTGG - Intronic
1015283607 6:131460037-131460059 CAGCTGAGACAGCATGAACAGGG - Intergenic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1017408198 6:154142110-154142132 CAGCAGAGACGGCCAGAGGTTGG - Intronic
1017837556 6:158192801-158192823 CAGCTTAGGGAGGCTGAGGTGGG + Exonic
1019502162 7:1369731-1369753 CGGCTGAGACAGCCTGGGTGGGG - Intergenic
1020115768 7:5475564-5475586 CAGCTGAGACAGCCTTGGGCTGG - Intronic
1021192725 7:17641035-17641057 GACCTTAGACAGCCTGAAGTAGG - Intergenic
1022356879 7:29624144-29624166 CAGCTGAGTCAGCCTGCCCTCGG + Intergenic
1023124935 7:36946050-36946072 CAGCAGAGGTAGCCTGAGCTGGG + Intronic
1023628404 7:42139084-42139106 CAGCAGGGCCAGGCTGAGGTTGG - Intronic
1023777795 7:43625788-43625810 CAGCAGAAACAGGCTGTGGTTGG - Exonic
1026765853 7:73159115-73159137 CACCTCTGACAGGCTGAGGTGGG - Intergenic
1027042327 7:74968812-74968834 CACCTCTGACAGGCTGAGGTGGG - Intronic
1027081315 7:75233546-75233568 CACCTCTGACAGGCTGAGGTGGG + Intergenic
1027121080 7:75520869-75520891 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1028516359 7:91681702-91681724 CATCTGAGACCACCTCAGGTTGG + Intergenic
1028569291 7:92268587-92268609 CAGCTACGGGAGCCTGAGGTGGG - Intronic
1029861565 7:103577931-103577953 CAGGTGAGAGAGCCTGAAGCTGG - Intronic
1030221468 7:107103528-107103550 AAGCTCAGATAGCCTGAGGCTGG + Intronic
1031740120 7:125418832-125418854 CAGCTCAGACATGCTGAAGTTGG + Intergenic
1032662755 7:134003864-134003886 CTGCTGAGGAAGTCTGAGGTGGG - Intronic
1033038128 7:137894225-137894247 CAGCTAAGGAAGCCTGAGCTTGG - Intronic
1033325117 7:140371285-140371307 CAGCTGAGGGAGGCTGAGGCAGG - Intronic
1034424866 7:151009149-151009171 CAAATGAGGCAGCCTGAGCTAGG - Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034601295 7:152259000-152259022 CAGCTGTGATACCCTGAGGATGG + Intronic
1034681004 7:152927343-152927365 CAGCTGTGGAAGGCTGAGGTGGG + Intergenic
1034970857 7:155418285-155418307 CAGCTGAGGCAGCCTGAAGGAGG + Intergenic
1035796590 8:2362844-2362866 CAGCTGTGACACCCAGAGGCAGG - Intergenic
1036750432 8:11440260-11440282 CAGCTAAGACGGCCTGACCTTGG - Intronic
1038748918 8:30278341-30278363 CAGCTGAGGGAGGCTGAGGCAGG + Intergenic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1041790767 8:61693982-61694004 CAGCAGAGCCAGCCTCAGCTGGG + Intronic
1043870407 8:85425533-85425555 CAGCTGAGACATCTGGAGATGGG - Intronic
1044188242 8:89282153-89282175 AAGCTGAGACATTTTGAGGTGGG - Intergenic
1045323665 8:101101035-101101057 GAGCTGGGAGAGCCTGAGGGAGG - Intergenic
1049426482 8:142540198-142540220 GAGCTGGGACAGCCCCAGGTGGG + Intronic
1049579916 8:143406574-143406596 TAGCTGAGGCTGCCTGGGGTTGG - Intergenic
1050364939 9:4865086-4865108 CACCTAAAACAGCCTGAGGTTGG - Intronic
1051595260 9:18818677-18818699 CAGCTGAGGGAGGCTGAGATGGG + Intronic
1052961003 9:34296423-34296445 AGGCTGAGGCAGGCTGAGGTAGG + Intronic
1053546343 9:39026920-39026942 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1053575856 9:39357263-39357285 CAGTTGAAGAAGCCTGAGGTGGG + Intronic
1053810658 9:41848582-41848604 CAGGTGAGACAGGATGGGGTGGG + Intergenic
1053840372 9:42185200-42185222 CAGTTGAAGAAGCCTGAGGTGGG + Intronic
1054097425 9:60915954-60915976 CAGTTGAAGAAGCCTGAGGTGGG + Intergenic
1054118828 9:61191584-61191606 CAGTTGAAGAAGCCTGAGGTGGG + Intronic
1054588924 9:66990978-66991000 CAGTTGAAGAAGCCTGAGGTGGG - Intergenic
1054619935 9:67338857-67338879 CAGGTGAGACAGGATGGGGTGGG - Intergenic
1055986931 9:82062140-82062162 CAGTTGAAGAAGCCTGAGGTGGG - Intergenic
1056098866 9:83281378-83281400 CAGCTGTGACAGCCAGAGTGTGG - Intronic
1056584463 9:87919422-87919444 CAGTTGAAAAAACCTGAGGTGGG + Intergenic
1056612403 9:88133498-88133520 CAGTTGAAAAAACCTGAGGTGGG - Intergenic
1056888824 9:90470244-90470266 CTGCTGGGACAGACTGAAGTGGG + Intergenic
1057160247 9:92884074-92884096 CAGTTGAAGAAGCCTGAGGTGGG + Intergenic
1058681639 9:107445491-107445513 CACCTGACCCAGCCTGGGGTAGG + Intergenic
1059419861 9:114184153-114184175 CAGATGACACAGGCTGAGCTGGG - Intronic
1059434330 9:114267108-114267130 CAGCTTAGCCAGCGTGAGGCGGG - Intronic
1060485160 9:124041948-124041970 GAGCTGAGCCTGCCTGAGGAGGG + Intergenic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1061183425 9:129038071-129038093 GACCTGAGCCAGCCTGGGGTTGG + Intronic
1061266968 9:129511756-129511778 GAGCTGAGACATCCTGAGGCTGG - Intergenic
1062235364 9:135505409-135505431 CAGGTGAGACACTCTGAGCTGGG + Intergenic
1062342249 9:136098949-136098971 CAGCCGAGAGAGCCTGTGCTGGG - Intergenic
1062425186 9:136502995-136503017 CAGCTGTGACCGCCGCAGGTGGG + Intronic
1185747900 X:2586122-2586144 CTGCTGGGAGACCCTGAGGTGGG - Intergenic
1188487847 X:30702962-30702984 CATCTGAGTCAGCCTGAGTCTGG + Intronic
1188700328 X:33251744-33251766 CAACTGAGAAAACCTGTGGTTGG + Intronic
1190472252 X:50794102-50794124 CAAGTTAGACACCCTGAGGTAGG + Intronic
1191884498 X:65874575-65874597 CAGGGGAGACAGACTGGGGTTGG + Intergenic
1192568803 X:72185256-72185278 CAGATGAGCCTGCCTGAGGGAGG - Intronic
1192846025 X:74907918-74907940 CAGCTGAGACAGCCTGAGGTGGG - Intronic
1195869614 X:109472457-109472479 CAGCTGAGAAGGTCTGAGGAAGG - Intronic
1196020322 X:110984477-110984499 CAGCTGAGGCAGCTGGAAGTGGG - Intronic
1197717077 X:129717317-129717339 GAGCTGGGACAGCCTGGGTTGGG + Intergenic
1198934878 X:141895242-141895264 CAGCAGAGGCAGCGTGGGGTGGG - Intronic
1199466865 X:148147777-148147799 CAGGTGTGAAAGCCTGTGGTGGG - Intergenic
1200083593 X:153591831-153591853 CAGCTGTGAGTGCCTGAGGCTGG - Intronic