ID: 1192855093

View in Genome Browser
Species Human (GRCh38)
Location X:75000511-75000533
Sequence TCAGGGGGGCTCAGAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192855093_1192855103 13 Left 1192855093 X:75000511-75000533 CCACTGGCTCTGAGCCCCCCTGA No data
Right 1192855103 X:75000547-75000569 CCTAGGAGTTGCAATTCTTGTGG No data
1192855093_1192855101 -4 Left 1192855093 X:75000511-75000533 CCACTGGCTCTGAGCCCCCCTGA No data
Right 1192855101 X:75000530-75000552 CTGAGTATTAGGGCTTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192855093 Original CRISPR TCAGGGGGGCTCAGAGCCAG TGG (reversed) Intergenic
No off target data available for this crispr