ID: 1192859292

View in Genome Browser
Species Human (GRCh38)
Location X:75048531-75048553
Sequence CTCAGGTAACACTTGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192859283_1192859292 5 Left 1192859283 X:75048503-75048525 CCCTGAATGGAGCATCCAGGGTG No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data
1192859287_1192859292 -10 Left 1192859287 X:75048518-75048540 CCAGGGTGGAACACTCAGGTAAC No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data
1192859284_1192859292 4 Left 1192859284 X:75048504-75048526 CCTGAATGGAGCATCCAGGGTGG No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data
1192859276_1192859292 28 Left 1192859276 X:75048480-75048502 CCCCATCATCTTCAGCATACAGG No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data
1192859279_1192859292 26 Left 1192859279 X:75048482-75048504 CCATCATCTTCAGCATACAGGCC No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data
1192859278_1192859292 27 Left 1192859278 X:75048481-75048503 CCCATCATCTTCAGCATACAGGC No data
Right 1192859292 X:75048531-75048553 CTCAGGTAACACTTGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192859292 Original CRISPR CTCAGGTAACACTTGGATGG GGG Intergenic
No off target data available for this crispr