ID: 1192859447

View in Genome Browser
Species Human (GRCh38)
Location X:75050687-75050709
Sequence CTTGAAAAGCAGTTATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192859447_1192859449 9 Left 1192859447 X:75050687-75050709 CCCTACAATAACTGCTTTTCAAG No data
Right 1192859449 X:75050719-75050741 ATTTTGTTAGTTGAAAATAATGG No data
1192859447_1192859450 25 Left 1192859447 X:75050687-75050709 CCCTACAATAACTGCTTTTCAAG No data
Right 1192859450 X:75050735-75050757 ATAATGGTTAATGACGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192859447 Original CRISPR CTTGAAAAGCAGTTATTGTA GGG (reversed) Intergenic
No off target data available for this crispr