ID: 1192862209

View in Genome Browser
Species Human (GRCh38)
Location X:75086967-75086989
Sequence AGCCATATAAAGCAACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 6, 3: 22, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192862209_1192862211 -10 Left 1192862209 X:75086967-75086989 CCTGGAAGTTGCTTTATATGGCT 0: 1
1: 0
2: 6
3: 22
4: 182
Right 1192862211 X:75086980-75087002 TTATATGGCTTAAAAGGAGAAGG 0: 1
1: 1
2: 3
3: 29
4: 261
1192862209_1192862212 6 Left 1192862209 X:75086967-75086989 CCTGGAAGTTGCTTTATATGGCT 0: 1
1: 0
2: 6
3: 22
4: 182
Right 1192862212 X:75086996-75087018 GAGAAGGAACCCTTAGTTCCAGG 0: 1
1: 2
2: 30
3: 166
4: 441
1192862209_1192862216 28 Left 1192862209 X:75086967-75086989 CCTGGAAGTTGCTTTATATGGCT 0: 1
1: 0
2: 6
3: 22
4: 182
Right 1192862216 X:75087018-75087040 GAACTCCTCATCCCTTTTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192862209 Original CRISPR AGCCATATAAAGCAACTTCC AGG (reversed) Intronic
902060533 1:13638357-13638379 AACCATATCAAGCATCTACCAGG + Intergenic
902324285 1:15688946-15688968 TGCCATAAGAAGCAACCTCCTGG + Intronic
904584194 1:31570316-31570338 AGCCAGGTAAAGCAGGTTCCAGG - Intergenic
906925659 1:50113504-50113526 AGGCATATAAATTAACTGCCTGG - Intronic
912311876 1:108631049-108631071 AGACATATAAAGCTACTTTCAGG + Intronic
913658197 1:120981880-120981902 AACCATATAAAGTAACTTCCAGG + Intergenic
913659689 1:120995132-120995154 AAGCATATAAGGTAACTTCCTGG + Intergenic
914009552 1:143764949-143764971 AACCGTATAAAGTAACTTCCAGG + Intergenic
914011049 1:143778256-143778278 AAGCATATAAGGTAACTTCCTGG + Intergenic
914166785 1:145182873-145182895 AAGCATATAAGGTAACTTCCTGG - Intergenic
914522765 1:148433145-148433167 AACCATATAAAGTAACTTCCAGG + Intergenic
914648176 1:149673624-149673646 AACCGTATAAAGTAACTTCCAGG + Intergenic
914649670 1:149686911-149686933 AAGCATATAAGGTAACTTCCTGG + Intergenic
915026598 1:152836462-152836484 AGCAATAAACAGAAACTTCCTGG - Intergenic
915428634 1:155847969-155847991 AACCATATAAGGTAACTTCTAGG - Intronic
916411183 1:164548713-164548735 CTCCATCTAAAGTAACTTCCAGG + Intergenic
916476710 1:165176238-165176260 AGAGACATAAAGTAACTTCCTGG + Intergenic
919013204 1:191992312-191992334 AACCATAAAAGGTAACTTCCAGG - Intergenic
919246325 1:194990368-194990390 AGCAAGATAAAGAAAATTCCAGG - Intergenic
919467115 1:197935294-197935316 AGCCATATGTAGAAAGTTCCTGG + Exonic
921791553 1:219296258-219296280 AGCCATCAAAGGCATCTTCCTGG - Intergenic
923445800 1:234070041-234070063 AGCCATTTAAACCAACTTCCTGG - Intronic
924156970 1:241187761-241187783 AGCCATAGAAAGTAACTTTCAGG - Intronic
1064708670 10:18099316-18099338 AGTCATATAAAGGAAATTACTGG - Intergenic
1067137304 10:43622238-43622260 AGCTATAAAAAGCAAATCCCTGG + Intergenic
1068965666 10:62910265-62910287 AACCAAAAAAAACAACTTCCGGG + Intronic
1069706905 10:70464552-70464574 ACCCATACAAAGCAACATCATGG - Intergenic
1070727197 10:78800445-78800467 AGCCATAAACAGCAAGTTCAGGG - Intergenic
1074032114 10:109699366-109699388 AAGCATATAAAGTAACTTCTTGG - Intergenic
1075817500 10:125276477-125276499 AGCCATATAATGAAATTTCAAGG + Intergenic
1076083918 10:127608163-127608185 AACCATATAAGGTAACTTTCAGG + Intergenic
1079662568 11:23058399-23058421 AACCATAGAAGGCAACTTTCGGG - Intergenic
1080812824 11:35722559-35722581 GACCATATAGAGTAACTTCCTGG + Intronic
1083543497 11:63531511-63531533 AACCATCTAAGGTAACTTCCAGG + Intergenic
1087770821 11:102207956-102207978 AGGCAGATAAAGGAACTTCAAGG - Intronic
1088340104 11:108755286-108755308 AGCTATAAAAAGTAACTTCAAGG - Intronic
1089393937 11:118122627-118122649 TGCCATAGAAATCTACTTCCAGG + Intergenic
1090949650 11:131462714-131462736 AGCATTGTACAGCAACTTCCAGG + Intronic
1093327135 12:17790170-17790192 TACCATATATAGCAACTCCCAGG + Intergenic
1094444457 12:30514600-30514622 AGCCATATATAAAAACTTTCTGG - Intergenic
1095758414 12:45797685-45797707 TGCCATACTAAGCAAATTCCAGG - Intronic
1095759074 12:45807125-45807147 ATACATTTAAAGCAACTTCAAGG - Intronic
1096905710 12:54933423-54933445 GGCCATACAGGGCAACTTCCTGG + Intergenic
1100252502 12:92842518-92842540 GTACATATACAGCAACTTCCTGG + Exonic
1101284095 12:103291661-103291683 AACCATATAAGGTAACTTCTGGG + Intronic
1107466397 13:40654648-40654670 AGCCACATATAGAAATTTCCAGG - Intronic
1108511412 13:51159267-51159289 ATCCACAAAAAGCAACCTCCGGG - Intergenic
1108724843 13:53169119-53169141 AGCCATACCGAGAAACTTCCAGG + Intergenic
1110548063 13:76779038-76779060 ACCCATATAAAGCAACTGCAAGG + Intergenic
1110938241 13:81318836-81318858 AGCCTAATTAGGCAACTTCCTGG + Intergenic
1111522205 13:89420431-89420453 AATCATATAAAACAAATTCCTGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114374688 14:22131707-22131729 AGCCATATAAGGTAACTTCTGGG - Intergenic
1117557909 14:56905580-56905602 AGCCATATAAGGTAACTTCCAGG - Intergenic
1118089137 14:62453082-62453104 AGTCATATAAAGCCACTTGTTGG + Intergenic
1120286592 14:82510244-82510266 AACCATATAAGGTAACTTCCAGG - Intergenic
1125909097 15:43420505-43420527 AGCCCTACAAAGCTATTTCCTGG + Exonic
1126956057 15:53935066-53935088 AGCAATATAATTAAACTTCCTGG - Intergenic
1127828221 15:62725075-62725097 AGCCAGCTGAAGCCACTTCCAGG + Exonic
1130132218 15:81153557-81153579 AGCCAAATAAAACAAACTCCAGG - Intergenic
1130425540 15:83794678-83794700 AGCTATAAAAGGCAACTTGCAGG + Intronic
1132181020 15:99752950-99752972 AGCAATGCAAAGCCACTTCCTGG + Intergenic
1133151608 16:3836514-3836536 AGGCATACAAAGGAACTTTCTGG + Intronic
1133434856 16:5770393-5770415 AACCCTATAAGGTAACTTCCAGG - Intergenic
1134324930 16:13198811-13198833 AACCACATAAAGCAAATTTCTGG - Intronic
1136563528 16:31055731-31055753 AGCCATAGAAAACCATTTCCAGG + Intergenic
1137601841 16:49761568-49761590 AGCCATAAAAACCACCTCCCAGG + Intronic
1137695383 16:50458384-50458406 GACCATATAGGGCAACTTCCTGG - Intergenic
1137863530 16:51870547-51870569 AGCCAAAGAAAGTAACATCCTGG + Intergenic
1138935649 16:61718690-61718712 AGCCATATAAAGCTCATTCATGG - Intronic
1139681233 16:68565460-68565482 AACTATTTAAAGCAACTTCTTGG + Exonic
1140058719 16:71548667-71548689 GACCATATAGAGCAACTTCCAGG - Intronic
1141660600 16:85439188-85439210 AGCCACATAAATCACCATCCAGG - Intergenic
1146501384 17:33367826-33367848 AGAAAAATAAAGCAAGTTCCAGG - Intronic
1154086220 18:11308087-11308109 AACCATATAAGGTAACTTCTGGG - Intergenic
1155633254 18:27920898-27920920 AACAATATAAAGCAAATTCATGG - Intergenic
1156393692 18:36677447-36677469 AGCCATATAAAACAAAATACAGG - Intronic
1156905126 18:42343305-42343327 AGAGAAACAAAGCAACTTCCAGG - Intergenic
1157672492 18:49542097-49542119 AGCCAAACACAGCTACTTCCTGG - Intergenic
1161949439 19:7459682-7459704 AGGCATGTAAAGCCTCTTCCTGG + Intronic
1162741111 19:12774404-12774426 AACCATAAAAATTAACTTCCAGG - Intronic
1162941151 19:14010221-14010243 GTCCATATAAAGTAACTTCCTGG - Intergenic
1167507671 19:49879470-49879492 AGTGATGTAACGCAACTTCCTGG - Intronic
926155624 2:10452358-10452380 AGGCATAGAAAGCAGCTTTCAGG + Intergenic
928448258 2:31352405-31352427 AGACACATAAAGCAACTTGTGGG - Intronic
928476970 2:31637483-31637505 AACCATATAAATTGACTTCCAGG - Intergenic
929344926 2:40870600-40870622 AGCCATACCAGGCAACTTCATGG - Intergenic
932831225 2:74991989-74992011 AACCATATAAAGTAACTTCCCGG + Intergenic
935289731 2:101599995-101600017 AACCATATAGGGTAACTTCCAGG - Intergenic
936493651 2:112998306-112998328 TGGATTATAAAGCAACTTCCTGG - Intergenic
936895864 2:117426834-117426856 CCCCATATAAAGCATCTCCCAGG + Intergenic
937133165 2:119528473-119528495 AGGCAGATAAAGAAACTTCAGGG - Intergenic
938616155 2:133000993-133001015 AAGGATATAAAGGAACTTCCTGG + Intronic
938710773 2:133974557-133974579 AACCATATACAGTAACTTTCAGG + Intergenic
941863288 2:170307615-170307637 GGCAAAATAAAGAAACTTCCTGG - Intronic
943731043 2:191304245-191304267 AGCCACAAAAAGCAACATACTGG - Intronic
944745048 2:202646621-202646643 AGCAATATATCTCAACTTCCTGG - Intronic
946478050 2:220028041-220028063 GGCTATAGAAAGCAACTGCCAGG - Intergenic
946732705 2:222724493-222724515 AACCATATAAGGTAACTTCTGGG + Intergenic
1169815303 20:9650340-9650362 AGTCATATAAATCAACTTAAAGG - Intronic
1170610771 20:17911034-17911056 AACCATATAAGGTAACTTCTGGG - Intergenic
1171313641 20:24166918-24166940 AGCTATATGAAGCACATTCCTGG - Intergenic
1172246784 20:33450926-33450948 AACCATATAAGGTAACTTCTGGG + Intergenic
1174004577 20:47400522-47400544 AACCACATAAATTAACTTCCAGG - Intergenic
1174215097 20:48910520-48910542 AACCATATAAAGTAACTTCCTGG + Intergenic
1174422293 20:50407321-50407343 AGCCATAGAAAGTGAGTTCCTGG + Intergenic
1174431195 20:50470584-50470606 AACTATATAAGGTAACTTCCAGG + Intergenic
1174547783 20:51338791-51338813 GACCATATAAGGCAACTTCCAGG + Intergenic
1182964808 22:34511036-34511058 AACCATATAAGGTAACTTCTGGG + Intergenic
951382268 3:21998116-21998138 AACCATATAAGGTAACTTCCAGG - Intronic
951770370 3:26249105-26249127 AGCCCTAGAAAGCAACCTCATGG - Intergenic
953416035 3:42718329-42718351 GGCCATATAGGGTAACTTCCTGG - Intronic
954918739 3:54171176-54171198 AGCCTCAGTAAGCAACTTCCCGG - Intronic
956428046 3:69156891-69156913 AGCCATATAAAGATACAACCTGG - Intergenic
959032528 3:101317034-101317056 AGCGATAGAAAGCAAATTCATGG + Intronic
959882665 3:111463255-111463277 TGCAGTATAAAGCAACTGCCAGG + Intronic
960407977 3:117285204-117285226 AGGCATACAAGGCAACATCCAGG + Intergenic
961864008 3:129940376-129940398 AATCATATAAGGTAACTTCCTGG - Intergenic
964316342 3:155448481-155448503 TCCAATATCAAGCAACTTCCTGG - Intronic
965189842 3:165514153-165514175 AGCCATAGAGAGCAATTTCCAGG + Intergenic
966681647 3:182647685-182647707 AGGGATATACAGCAACTTTCCGG + Intergenic
967936745 3:194734627-194734649 ATCCATAAGAAGCAACTCCCTGG + Intergenic
967938990 3:194751828-194751850 AGTCATGTACAGCAACTCCCAGG - Intergenic
969191532 4:5524992-5525014 AACCATATATGGTAACTTCCAGG + Intronic
974498286 4:62662172-62662194 AGCCAGAAAAAGCCACATCCAGG - Intergenic
975935342 4:79572916-79572938 ACCAATATAATGCATCTTCCAGG - Intergenic
980155450 4:129098824-129098846 AACCATATAAGGTAACTTCTAGG + Intronic
980314653 4:131182042-131182064 AACCATATAAGGTAACTTCCAGG - Intergenic
980334907 4:131459747-131459769 AACCATATAAGGTAACTTCTGGG - Intergenic
983593925 4:169444605-169444627 AGATATATAAAGCAACTACAGGG + Intronic
986308580 5:6533732-6533754 GACCATATAGAGAAACTTCCGGG - Intergenic
991541130 5:67729667-67729689 AGCCATATTATGCCACTTCATGG + Intergenic
994021601 5:95032373-95032395 AATCATATAAAGCATCTTCTGGG + Intronic
994118489 5:96088103-96088125 AGCTCTATACAGCAACATCCTGG + Intergenic
994445105 5:99862381-99862403 AACCAAATAAAGCAAATCCCAGG + Intergenic
995199846 5:109413670-109413692 ATCCATATAAGGTAACTTTCAGG + Intergenic
998128717 5:139640466-139640488 AGACAGATATAGGAACTTCCCGG - Intergenic
998212784 5:140213569-140213591 ACTCATCTAGAGCAACTTCCAGG + Intronic
998517280 5:142768088-142768110 AACCATATAAGGTAACTTCCAGG + Intergenic
999455039 5:151708255-151708277 AACCCAATTAAGCAACTTCCTGG + Intergenic
999610957 5:153369025-153369047 AGCCATAAAAATAAACTTCTTGG + Intergenic
999627444 5:153535432-153535454 TGTCAAATAAAGCAACCTCCTGG + Intronic
999991088 5:157050578-157050600 AGCCATATAAACCAACTCTTAGG + Intronic
1003510579 6:6776387-6776409 AACCATATAAAGTAAATTCTGGG + Intergenic
1007025477 6:38568018-38568040 AGGAATATAAAGCAAGGTCCAGG + Intronic
1007159872 6:39780446-39780468 AGCAATAAAAAGCAAATTTCTGG - Intergenic
1008483795 6:52013882-52013904 AGCCACAGGAAGCAACTTCAGGG - Intronic
1012385003 6:98670479-98670501 AGCCATTTAAAGCAAATATCAGG - Intergenic
1012759325 6:103278377-103278399 AACCATGTAAGGCAACTTCTGGG + Intergenic
1012947654 6:105485025-105485047 AGCGATATAATACAACTTCATGG - Intergenic
1013335788 6:109159339-109159361 AGCCTTCTAGAACAACTTCCTGG + Exonic
1013916294 6:115341213-115341235 AGAAATATAAAGCAACTTATTGG + Intergenic
1016906567 6:149156644-149156666 AGCCATATAAAGAAACCTCAGGG - Intergenic
1017923885 6:158894238-158894260 AACCATATAAAGTAACTTCTGGG + Intronic
1019038879 6:169086447-169086469 AGACATATAGGGTAACTTCCTGG - Intergenic
1019867219 7:3722947-3722969 AAACATGTAAAGCAATTTCCAGG - Intronic
1019963018 7:4477043-4477065 AGAAAAAGAAAGCAACTTCCCGG + Intergenic
1023303327 7:38797051-38797073 ATCCATTTTAAACAACTTCCTGG - Intronic
1023499082 7:40829133-40829155 AACCATATAAGGAAACTTCTGGG - Intronic
1023620806 7:42070277-42070299 AGCCATAAAAAGCCACGTTCAGG - Intronic
1024652701 7:51419239-51419261 AGCCATATAGAGTAAGTTCTGGG + Intergenic
1027231728 7:76276599-76276621 AGGCACAAAAAGCAGCTTCCTGG + Intronic
1027371664 7:77512682-77512704 AGCTATAAAAAGCGACTTACTGG - Intergenic
1028722359 7:94048202-94048224 AGCAATCTAAGGCAATTTCCAGG - Intergenic
1029123570 7:98283350-98283372 AGCCTTAGCAGGCAACTTCCTGG + Intronic
1030101169 7:105946449-105946471 AGTCAGATCCAGCAACTTCCCGG - Intronic
1031325802 7:120395703-120395725 AATCATATAAGGTAACTTCCAGG + Intronic
1032421799 7:131786369-131786391 AACTACATAAAGTAACTTCCGGG + Intergenic
1032987823 7:137358641-137358663 AACCATATAAGATAACTTCCAGG + Intergenic
1032988498 7:137364459-137364481 AACCATATAAGGTAACTTCCAGG + Intergenic
1034999780 7:155603533-155603555 AGCCATAGTGAGCAATTTCCTGG - Intergenic
1035650990 8:1264726-1264748 ACCCATATAAAGAAACTTTAAGG + Intergenic
1036178364 8:6561716-6561738 GTCCATATAAAGAAAATTCCAGG + Intronic
1036957947 8:13211159-13211181 AACCACATAATGTAACTTCCAGG - Intronic
1037339426 8:17827937-17827959 AGGAATAAAAAGAAACTTCCAGG + Intergenic
1038025502 8:23585499-23585521 ATCCATAAGAAGCAACTTCTTGG + Intergenic
1038134466 8:24770409-24770431 AGCCATATAAGGTAACTTCTGGG - Intergenic
1039605488 8:38877016-38877038 GGCCATGCCAAGCAACTTCCAGG - Intergenic
1042794826 8:72650194-72650216 AGCTATATATAGAAACTTCTAGG - Intronic
1043544237 8:81297212-81297234 ACCGATATAAGGCAAGTTCCTGG + Intergenic
1043754477 8:83985789-83985811 AGCCATGTAAGCTAACTTCCAGG + Intergenic
1044161903 8:88929330-88929352 AGCCCTATAAATGAACATCCGGG + Intergenic
1044476657 8:92634238-92634260 ACCCATAAAAAGAAATTTCCTGG - Intergenic
1044867451 8:96586262-96586284 AGCCCTTTAAAGAAACTACCTGG - Intronic
1045652187 8:104351663-104351685 AGCCATGTAACACAACTTCTGGG + Intronic
1046143973 8:110133129-110133151 ACCCATTTAAAGCATCTGCCAGG + Intergenic
1047576507 8:126161537-126161559 AGACATCTAAAGCAACTTTAGGG + Intergenic
1047942099 8:129836243-129836265 AACCATATAAGGTAACTTCCAGG + Intergenic
1055342389 9:75297947-75297969 AGCCATATACAGTAATGTCCTGG + Intergenic
1058776166 9:108285993-108286015 AGCCATATCAATCTACTTGCAGG - Intergenic
1058920876 9:109613536-109613558 AGGCATATAAAGGGACTTCTAGG - Intergenic
1059199517 9:112401124-112401146 AGACATCTAAAATAACTTCCTGG - Intronic
1059510875 9:114845327-114845349 AGCCATAAAAAGCAAAATCATGG + Intergenic
1060919641 9:127410914-127410936 GACCATATTAAGTAACTTCCTGG + Intergenic
1203449457 Un_GL000219v1:98972-98994 AGACATATTAACCAATTTCCTGG + Intergenic
1185880024 X:3732537-3732559 GACCATATAAGGTAACTTCCAGG + Intergenic
1189830843 X:44971760-44971782 AGCCAGATGAAGGAACTTACAGG + Intronic
1189914257 X:45841423-45841445 GGCTATATACAGCAGCTTCCAGG + Intergenic
1190098777 X:47504304-47504326 AGCCAGTTAAAACAAATTCCAGG - Intergenic
1191058218 X:56265969-56265991 TGACATATCAAACAACTTCCTGG + Intronic
1191126801 X:56964636-56964658 AGGCTTATATAGCAACTTACTGG - Intergenic
1191920516 X:66251682-66251704 AGCCATATTAAGAAAGTTACAGG + Intronic
1192862209 X:75086967-75086989 AGCCATATAAAGCAACTTCCAGG - Intronic
1192888358 X:75361954-75361976 AGCCATACAAGGTAACTTCCTGG - Intergenic
1194130165 X:90071991-90072013 AGATATATAAAGCAAGTTCTTGG - Intergenic
1194869071 X:99105224-99105246 AGCCATATGAAGCACATCCCAGG - Intergenic
1195095996 X:101501710-101501732 AACCATATAAGGCAACTTCTAGG + Intronic
1196314270 X:114204319-114204341 AACCATATAAGGCAATTTCTGGG - Intergenic
1197850743 X:130857325-130857347 AGTCATATAGAGAAACTTTCTGG + Intronic
1199998795 X:153045604-153045626 AACCATATAAGGTAACTTCCAGG - Intergenic
1200785841 Y:7259671-7259693 GACCATATAAGGTAACTTCCAGG - Intergenic