ID: 1192866662

View in Genome Browser
Species Human (GRCh38)
Location X:75140776-75140798
Sequence ATGCTCTTTAATTTAAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192866657_1192866662 7 Left 1192866657 X:75140746-75140768 CCCACCTTCACTTTCTGACCTTG 0: 1
1: 1
2: 1
3: 18
4: 291
Right 1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1192866658_1192866662 6 Left 1192866658 X:75140747-75140769 CCACCTTCACTTTCTGACCTTGT 0: 1
1: 1
2: 4
3: 40
4: 595
Right 1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1192866659_1192866662 3 Left 1192866659 X:75140750-75140772 CCTTCACTTTCTGACCTTGTTCT 0: 1
1: 0
2: 1
3: 36
4: 412
Right 1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 190
1192866656_1192866662 10 Left 1192866656 X:75140743-75140765 CCTCCCACCTTCACTTTCTGACC 0: 1
1: 0
2: 0
3: 38
4: 519
Right 1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG 0: 1
1: 0
2: 0
3: 12
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192866662 Original CRISPR ATGCTCTTTAATTTAAAGGC AGG Intronic
903412857 1:23160561-23160583 ATTTTCTCTAATCTAAAGGCCGG - Intronic
904315612 1:29658541-29658563 ATTCCCTTTATTTTTAAGGCTGG + Intergenic
904653958 1:32028370-32028392 ATCTTCTATAATTTTAAGGCGGG - Intronic
904954197 1:34269268-34269290 ATGCTCTTTGATAAAAAGGGAGG - Intergenic
911341206 1:96640872-96640894 TTAATCTTTAATTTACAGGCAGG - Intergenic
911978675 1:104537285-104537307 ATGCTCTTTAACTTAAAATGGGG - Intergenic
912173013 1:107123762-107123784 ATCCTCTTTATTCTAAATGCAGG - Intergenic
913569002 1:120101726-120101748 ATGCAAGTTAATTTAAAGCCTGG - Intergenic
914314890 1:146500716-146500738 TTTCTTTTTAATTTAAAGACAGG + Intergenic
914499462 1:148232671-148232693 TTTCTTTTTAATTTAAAGACAGG - Intergenic
915529743 1:156496504-156496526 ATGCTCTTTATTTTGCAGACAGG + Intronic
916208266 1:162336253-162336275 ATGCTCTTCATTTTATAGGTGGG + Intronic
917873408 1:179262913-179262935 CTCCTCTTTAATTTAAAGCGTGG + Intergenic
919377565 1:196813977-196813999 ATGATCATTAATTTAAAGCAAGG + Intergenic
919387079 1:196935874-196935896 ATGATCATTAATTTAAAGCAAGG + Intronic
919643105 1:200064722-200064744 ATGCACTTTAAGCTAAATGCTGG - Intronic
922118457 1:222637409-222637431 TTCCTCCTTCATTTAAAGGCTGG + Intronic
922355944 1:224775165-224775187 ATGTTCTATAATTTGAAGGGGGG - Intergenic
1063492092 10:6473336-6473358 ATGCTCTTTAAATTAGATTCTGG + Intronic
1063791781 10:9457619-9457641 ATTCTACTTAATTTAGAGGCTGG + Intergenic
1064865891 10:19879391-19879413 ATGCTGTTTTATTTAAATTCTGG + Intronic
1066344582 10:34571782-34571804 TTACTCTTTTATTTAAATGCAGG + Intronic
1067003059 10:42635832-42635854 ATACACTTTAATTTATTGGCCGG + Intronic
1067159810 10:43816208-43816230 ATCCTCTTTCATTTAAAGTAGGG - Intergenic
1067251353 10:44589494-44589516 ATTATTTTTAATTGAAAGGCAGG - Intergenic
1067976214 10:51028199-51028221 ATGCTAATTTATTTAAATGCAGG + Intronic
1068066810 10:52142191-52142213 AAGCTCTTTAATGTTAAGGGTGG + Intronic
1068906560 10:62331822-62331844 TTGCACTTCAATTAAAAGGCAGG - Intergenic
1070568603 10:77623077-77623099 ATGCTATTTAAATTCTAGGCAGG - Intronic
1071552228 10:86575453-86575475 ATGTTGTTAAATGTAAAGGCAGG - Intergenic
1073212410 10:101815913-101815935 ATGCTCATTCATTTTACGGCTGG + Intronic
1073504099 10:103968166-103968188 GTGTTCTTTAATTTATAGGAGGG + Intronic
1074644675 10:115434270-115434292 ATGATCATTATTTTAAAGTCAGG - Intronic
1076380024 10:130018543-130018565 AAGCTCTTTTCTTTAACGGCAGG + Intergenic
1081241510 11:40711810-40711832 ATGCTTTTTAATTTATAAGTTGG + Intronic
1081855740 11:46302356-46302378 GTGCTCTTTGCTTTAAAGGATGG - Intronic
1082774344 11:57234318-57234340 ATGCTCATAAATTTGAAGCCAGG + Exonic
1083144078 11:60745393-60745415 AGGCTCTTTAACATAAAGACAGG + Intergenic
1086019683 11:82211723-82211745 ATGGACTATAATTTAATGGCTGG - Intergenic
1086523031 11:87693161-87693183 ATGGTCATTAATTAAAAGTCAGG - Intergenic
1086915458 11:92524988-92525010 AGGCTGATGAATTTAAAGGCTGG - Intronic
1087340452 11:96898995-96899017 AAGCTCTTTAAATAAATGGCTGG - Intergenic
1087491994 11:98839437-98839459 CTGTACTATAATTTAAAGGCAGG + Intergenic
1087642952 11:100775036-100775058 ATGCTCTTCAATGAAAAGGGAGG - Intronic
1088013556 11:105033261-105033283 ATGTTCTTTAATTTAGAGAGTGG + Intronic
1088016680 11:105069634-105069656 ATGGTCTTTAATTTAGAGAGTGG + Intronic
1089956059 11:122572567-122572589 ATGCTGTTCACTTGAAAGGCTGG + Intergenic
1090127547 11:124103807-124103829 ATACTCTTTAGTGTAAACGCAGG - Intergenic
1094337073 12:29371780-29371802 ATGCTTTTTATTTTTAAGGGGGG - Intronic
1095621578 12:44262124-44262146 TTTCTCCTTATTTTAAAGGCAGG - Intronic
1097589428 12:61555973-61555995 TGGCTATTTAATTTAAAGTCTGG - Intergenic
1098524378 12:71469869-71469891 CTGCTCTTTCTTTTAAAAGCAGG + Intronic
1098637941 12:72807519-72807541 AAGGTCATTAATTTAAATGCAGG - Intergenic
1100351557 12:93788601-93788623 ATGTTCTTGATTTTAAAGGGAGG + Intronic
1103603022 12:122066097-122066119 ATGCTCTTCAATTTACAGTGGGG + Intergenic
1103614661 12:122144578-122144600 ATTTTCTTTTATTTAGAGGCAGG - Exonic
1105389723 13:19963979-19964001 ATGCTCTTTAATTTGAAAGAAGG + Intronic
1105468574 13:20670637-20670659 ATGATCTTTAGTTTAAGGGAGGG - Intronic
1113393894 13:109925736-109925758 ATGCTATTTAACATGAAGGCAGG - Intergenic
1115209170 14:30947437-30947459 ATGCTTTTTAATTTAAATTTTGG - Intronic
1115567664 14:34638618-34638640 ATGATCTAAAATTAAAAGGCAGG - Intergenic
1115582065 14:34770765-34770787 ATGCTCTATAATTTATAGTGAGG - Intronic
1115739667 14:36374788-36374810 GTGCTCTTTGATTTAAGTGCAGG - Intergenic
1118217400 14:63822306-63822328 ATGCTCTTTAGTTTCAGGGTAGG + Intergenic
1120458399 14:84761280-84761302 ATGCTTTATATTTTAAAAGCAGG - Intergenic
1120928606 14:89823687-89823709 ATGCTCTAGTATTTAAAGGAAGG + Intronic
1120993039 14:90395508-90395530 CTGCTGTTTAATTTAAAGAGAGG - Intergenic
1126605768 15:50474644-50474666 ATTCTCTTTTATTTACTGGCTGG - Intronic
1127414825 15:58748696-58748718 ATGTTCTTTGATTTGTAGGCTGG - Intronic
1130002318 15:80058763-80058785 ATCCTCTTTATTTTAAATGTTGG - Intergenic
1131003588 15:88957571-88957593 ATGCTGTTTATTTGAAAGTCTGG - Intergenic
1135250359 16:20896217-20896239 ATGCTCTTTGATTTACAGTGGGG - Intronic
1136591435 16:31220057-31220079 CTGGTCTTTTTTTTAAAGGCAGG + Intronic
1136644650 16:31601385-31601407 CTGCTATTTAATGTAAAGTCTGG + Intergenic
1138135976 16:54523107-54523129 TTGATATTTAATTCAAAGGCAGG - Intergenic
1138384130 16:56624995-56625017 TTGCTTTTTAATTTAAAGCAGGG + Intergenic
1138385761 16:56634950-56634972 TTGCTTTTTAATTTAAAGTAGGG + Intergenic
1139112756 16:63911641-63911663 CTACTCTTTAATTTAAAGCCTGG - Intergenic
1141059269 16:80850336-80850358 ATGATCTTGAATATAGAGGCTGG - Intergenic
1143743842 17:8975330-8975352 TTGCTATTTTAATTAAAGGCTGG - Intergenic
1143818354 17:9538916-9538938 ATGCTCTCGAATATAAAGGGCGG + Intronic
1146218549 17:30998673-30998695 AGGCTCTTCAAGTTAAAGGTTGG - Exonic
1146648115 17:34589036-34589058 GTGCTATTTATTTTAAAGGCAGG + Intronic
1147556129 17:41480295-41480317 TTCCTCTTTTATTTAAAGTCAGG - Intronic
1161465611 19:4428692-4428714 GTGCTCTTTAATTTCAAAGGGGG - Exonic
1165633123 19:37318222-37318244 ATGCCCTTTTATTTCTAGGCAGG + Intronic
926884343 2:17583739-17583761 ATGCACTTTTATGTAAAGGAAGG + Intronic
928787480 2:34906764-34906786 TAGCTCTTGAATTTAAAAGCAGG - Intergenic
928940961 2:36726966-36726988 ATCCTTTCTAATTTAAAGTCTGG - Intronic
930111787 2:47685014-47685036 ATTCTCTTTGGTTTCAAGGCTGG - Intergenic
931217789 2:60262597-60262619 ATTGTCTTTGATTTAAAAGCAGG + Intergenic
931623898 2:64237952-64237974 GTGCTCTTTGATTTAAAGGAAGG + Intergenic
931798182 2:65732157-65732179 AGGCTTTTTTATTTAAAGTCGGG + Intergenic
933193807 2:79366885-79366907 GTGCTATTTAATATAAAGGGTGG + Intronic
935300254 2:101687711-101687733 AGGCTATTTAATTAAAAAGCAGG + Intergenic
935593574 2:104862892-104862914 TTGATCTGTAATTGAAAGGCAGG - Intergenic
936765415 2:115841831-115841853 ATGCTCTTTAAATAAAGAGCTGG + Intronic
937674587 2:124575989-124576011 ATACTCTTTAAATAAAAAGCAGG - Intronic
938917853 2:135961566-135961588 ATGCTCTCTACTTTAAAAGTGGG + Intronic
939490423 2:142869473-142869495 ATTGTCTTTGATTTGAAGGCTGG + Intergenic
943588732 2:189771510-189771532 ATGCCCTTTAACTTATAAGCTGG + Exonic
943978587 2:194515380-194515402 ATACTGTATAAATTAAAGGCTGG + Intergenic
944202511 2:197122552-197122574 TTGCACTTTAATTCAAGGGCAGG - Intronic
946898688 2:224351731-224351753 ATGACCATTAATTTAAATGCTGG - Intergenic
947057243 2:226119234-226119256 ATGCTTTTTAATTAAAATGTAGG - Intergenic
947590112 2:231380557-231380579 ATCTTTTTTATTTTAAAGGCAGG - Intergenic
1169832164 20:9837422-9837444 TTGCTTTATAATTTAAAGGATGG - Intronic
1170461639 20:16582266-16582288 AGGCTTTTTATTTTAAAGTCAGG + Intergenic
1175721381 20:61289584-61289606 GGGCTCTTTAATCCAAAGGCAGG - Intronic
1177034962 21:16030765-16030787 ATTCTTTTTAATTTAAAGACAGG - Intergenic
1178346751 21:31835397-31835419 ATGCTCATGAATTAAAAGGGAGG + Intergenic
1183812881 22:40272649-40272671 AAGATCTTTAATTTGAAGACTGG - Intronic
952516546 3:34110161-34110183 ATGCACTTAAATCCAAAGGCAGG + Intergenic
962539669 3:136366730-136366752 ATGTTCTTTCATATAAATGCTGG + Intronic
962662815 3:137621445-137621467 ATGCTGTTTAATTTCAGGGAGGG - Intergenic
963920959 3:150905085-150905107 TTTCTCTTTCATTTAAAGGTTGG - Exonic
964917814 3:161857448-161857470 ATGCCCTTTAATTTAATTTCAGG - Intergenic
967907279 3:194511996-194512018 ATGCTCTGTATTTTACAGGTAGG - Intergenic
970038984 4:11774344-11774366 AGGCTTTCTAATTTAAAGGCAGG - Intergenic
970375530 4:15453161-15453183 ATCCTCTTTTTTTTAAAGACAGG - Intergenic
970497542 4:16641879-16641901 ATGTTCTTTCATATTAAGGCAGG - Intronic
970777775 4:19696821-19696843 ATGCCCTTTAATTAAAAAGTTGG - Intergenic
972351176 4:38237205-38237227 ATGCTCCTGGATTTAAAGGCAGG + Intergenic
973594376 4:52471224-52471246 ATGATCTTTATTTTAAAGATGGG - Intergenic
973595001 4:52478990-52479012 ATGCTCTTTCCTTTAGGGGCAGG - Intergenic
976895626 4:90107466-90107488 TAGCTGTTGAATTTAAAGGCTGG - Intergenic
977857486 4:101911291-101911313 ATTATCTTAAATTTAAAGGAAGG + Intronic
978395332 4:108272949-108272971 ATGATATTTAATTTAATGTCAGG + Intergenic
978669140 4:111225169-111225191 CTCCTCTTTATTTTCAAGGCTGG - Intergenic
980011688 4:127602462-127602484 ATACTCCTTAAGTTAAAGTCTGG - Intergenic
980324896 4:131330085-131330107 ATTGTCTTTAAATTAAAGTCTGG - Intergenic
980843388 4:138294445-138294467 AGACTCCATAATTTAAAGGCAGG + Intergenic
981182272 4:141759781-141759803 AAGGTCTTTAATTTAAAAGTTGG + Intergenic
981233566 4:142388244-142388266 ATGCTCTTAAATTTATTGCCTGG - Intronic
982226904 4:153174677-153174699 TTTCTCTTTATTATAAAGGCAGG + Intronic
983866972 4:172779208-172779230 TTGCCCTATATTTTAAAGGCTGG + Intronic
984583167 4:181533723-181533745 TTTTTTTTTAATTTAAAGGCAGG - Intergenic
985327911 4:188794162-188794184 ATGCTCAGTAATTTAAAGAAAGG + Intergenic
986627888 5:9739730-9739752 ATGCTCCTTCTTTTAAAGCCTGG + Intergenic
989023197 5:37034981-37035003 TTGGTCTTTTATTTAACGGCAGG - Intronic
989512307 5:42302316-42302338 ATCCTCTTTGAGTTGAAGGCCGG - Intergenic
990018483 5:51096291-51096313 ATGCTCTCTATTTTAAACTCAGG - Intergenic
990867266 5:60393570-60393592 ATACTCTTCAATTTAAAAGGAGG + Intronic
996128915 5:119757427-119757449 CTGCTATTTAATTTAAAGCCTGG - Intergenic
996461493 5:123749038-123749060 ATGCTCTTTCATTTATAGATGGG + Intergenic
996707950 5:126515799-126515821 ATTCTCTTAAATTTAGTGGCTGG - Intergenic
1000734053 5:164876324-164876346 AAGGTCTGTAATTTAAAAGCAGG + Intergenic
1004118005 6:12790124-12790146 ATCCTTTTTAAATGAAAGGCAGG + Intronic
1004479867 6:16008667-16008689 CTGCTATTTAATTAAAAGTCAGG + Intergenic
1005832861 6:29684616-29684638 ATGCTCTTCAATTTAAAATGGGG + Intergenic
1007203152 6:40128188-40128210 ATGCTCTTAGATTTAAACCCAGG + Intergenic
1009024330 6:57980213-57980235 ACACTGTTTAAGTTAAAGGCAGG + Intergenic
1009462760 6:63933905-63933927 AAGCTCTTTAGTTTAAAAGCAGG - Intronic
1009611808 6:65953986-65954008 ATGCTTTTTAATTTAATAGATGG + Intergenic
1009864483 6:69379609-69379631 CTCTTCTTTATTTTAAAGGCTGG + Intronic
1010799772 6:80162082-80162104 CTGGTCTTTAAGTTCAAGGCTGG + Intronic
1015269182 6:131322142-131322164 AAGGTCTTTAATTTAAAAGATGG - Intergenic
1015486042 6:133771121-133771143 ATGCTCTTTCATGTACAGACTGG - Intergenic
1016188284 6:141225816-141225838 ATTTTTTTTAAATTAAAGGCTGG + Intergenic
1016275215 6:142342478-142342500 ATAATCTTTAAGTTAATGGCAGG - Intronic
1016739513 6:147512619-147512641 ATGATGTTTGATTTAAAGCCTGG - Intronic
1020420022 7:7992388-7992410 ATGCTCTTCAATCAAAAGCCTGG - Intronic
1022446713 7:30477040-30477062 TTGCTCTTTATTTTACAGGTGGG + Intronic
1023591836 7:41788811-41788833 ATCCTCTTTACTTTAGAGGTAGG + Intergenic
1027532272 7:79351406-79351428 ATGCTCGTTAATAGCAAGGCTGG - Intronic
1027671153 7:81101126-81101148 ATGCTGTTTAATTACATGGCTGG + Intergenic
1028612624 7:92729345-92729367 AGGCTCTTTCAGTTAAACGCAGG + Intronic
1031924464 7:127625941-127625963 ATGCACTTTAATATAATAGCTGG + Intergenic
1033257896 7:139817635-139817657 ATGCTATTTAACTCAAAGACTGG - Intronic
1034543467 7:151775017-151775039 ATCCTCCTTAATGTCAAGGCTGG + Intronic
1034634864 7:152559184-152559206 ATCCTCATTGATTTTAAGGCTGG + Intergenic
1035826546 8:2650536-2650558 AGAGTCTTTTATTTAAAGGCTGG - Intergenic
1036676111 8:10834771-10834793 ATGCTTTTTCATTTACAGGTCGG - Exonic
1037658678 8:20908754-20908776 ATGTTCTTTATTTTACAGGTAGG - Intergenic
1039675593 8:39662464-39662486 TTGTCCTTTAATATAAAGGCAGG - Intronic
1040831195 8:51679198-51679220 ATCCTCTTTATTTTGAAGCCTGG + Intronic
1041175110 8:55188536-55188558 ATCCTCTTAAGTTTAAAGACAGG + Intronic
1041871440 8:62639075-62639097 ATGCCCTTTGATTTAAAGTCAGG + Intronic
1042530831 8:69813403-69813425 ATGCTCTTTATTTTTAAGCAGGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1044244307 8:89923760-89923782 ATGCTCTTCAATTTACAGTAGGG - Intronic
1047613267 8:126541548-126541570 CAGCTTTTTAATTTGAAGGCAGG - Intergenic
1047904208 8:129455355-129455377 AATCTCTTTATTTTCAAGGCTGG - Intergenic
1048569777 8:135642483-135642505 ATGGTCTTCAAATTAAGGGCTGG - Intronic
1050526144 9:6548582-6548604 GTGATCTTTAATTTAATGGCTGG - Intronic
1051031634 9:12687796-12687818 ATGCTCTTTATTGTAAATGTTGG - Intronic
1052914964 9:33918003-33918025 TTGCTATTTATTTTAAAGGCAGG + Exonic
1053235467 9:36449904-36449926 AAGCTCACTGATTTAAAGGCTGG + Intronic
1054824867 9:69563473-69563495 ATGCTTTTGAATTCAAAGGAAGG - Intronic
1054962499 9:70984329-70984351 AAGTTCTATAATTTGAAGGCTGG + Intronic
1055006266 9:71510759-71510781 AAGGCCTTTAATTTAAAGACAGG + Intergenic
1055560716 9:77519083-77519105 ATGCTTTTCACTCTAAAGGCAGG + Intronic
1057807010 9:98226565-98226587 GTGCTGTCTTATTTAAAGGCTGG + Intronic
1058412907 9:104753226-104753248 ATGCTCATTTTTTTAAAGGATGG - Intronic
1060426066 9:123506886-123506908 ATGCTCTTTCAAAAAAAGGCTGG + Intronic
1187808276 X:23145318-23145340 ATGCTCTTCATTTGAAAGTCTGG - Intergenic
1189396892 X:40631065-40631087 AAGCCCTTTCATGTAAAGGCAGG - Intronic
1189572525 X:42313587-42313609 AAACTCTCTAATTAAAAGGCAGG - Intergenic
1192866662 X:75140776-75140798 ATGCTCTTTAATTTAAAGGCAGG + Intronic
1194554923 X:95345207-95345229 ACGCCCTTTAATTATAAGGCAGG - Intergenic
1197043330 X:121966976-121966998 TTGCCCTGTAATTTAAAGGAAGG - Intergenic
1198262858 X:134981822-134981844 ATACTCTGTAATTTATAGACTGG + Intergenic
1200164234 X:154025223-154025245 ATGTTCTTGAATTCAAAGGTAGG + Intronic