ID: 1192866881

View in Genome Browser
Species Human (GRCh38)
Location X:75143376-75143398
Sequence CAAAATGCTGATAATGATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192866881_1192866884 5 Left 1192866881 X:75143376-75143398 CCATTATCATTATCAGCATTTTG No data
Right 1192866884 X:75143404-75143426 AGTCATTCAACAAGTCTCGAGGG No data
1192866881_1192866883 4 Left 1192866881 X:75143376-75143398 CCATTATCATTATCAGCATTTTG No data
Right 1192866883 X:75143403-75143425 AAGTCATTCAACAAGTCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192866881 Original CRISPR CAAAATGCTGATAATGATAA TGG (reversed) Intronic