ID: 1192868653

View in Genome Browser
Species Human (GRCh38)
Location X:75163807-75163829
Sequence CTCATCAGGCCTCACCTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192868653_1192868656 -4 Left 1192868653 X:75163807-75163829 CCTATTAGGTGAGGCCTGATGAG No data
Right 1192868656 X:75163826-75163848 TGAGTGATATTTAGGTCATGAGG No data
1192868653_1192868657 -3 Left 1192868653 X:75163807-75163829 CCTATTAGGTGAGGCCTGATGAG No data
Right 1192868657 X:75163827-75163849 GAGTGATATTTAGGTCATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192868653 Original CRISPR CTCATCAGGCCTCACCTAAT AGG (reversed) Intergenic
No off target data available for this crispr