ID: 1192873490

View in Genome Browser
Species Human (GRCh38)
Location X:75206465-75206487
Sequence AGTTTTTAAGAGCTGGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192873482_1192873490 26 Left 1192873482 X:75206416-75206438 CCTTAGTAATATCTTTGAGATTG No data
Right 1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG No data
1192873487_1192873490 -1 Left 1192873487 X:75206443-75206465 CCATGGTGGGAGAATCTATACAA No data
Right 1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192873490 Original CRISPR AGTTTTTAAGAGCTGGAGTA GGG Intergenic
No off target data available for this crispr