ID: 1192875348

View in Genome Browser
Species Human (GRCh38)
Location X:75223645-75223667
Sequence AGGGAAACTGCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192875348_1192875355 24 Left 1192875348 X:75223645-75223667 CCCACAATCACTGCAGTTTCCCT No data
Right 1192875355 X:75223692-75223714 CTGTATCACGTGGTCACTGCTGG No data
1192875348_1192875357 26 Left 1192875348 X:75223645-75223667 CCCACAATCACTGCAGTTTCCCT No data
Right 1192875357 X:75223694-75223716 GTATCACGTGGTCACTGCTGGGG No data
1192875348_1192875356 25 Left 1192875348 X:75223645-75223667 CCCACAATCACTGCAGTTTCCCT No data
Right 1192875356 X:75223693-75223715 TGTATCACGTGGTCACTGCTGGG No data
1192875348_1192875354 14 Left 1192875348 X:75223645-75223667 CCCACAATCACTGCAGTTTCCCT No data
Right 1192875354 X:75223682-75223704 GATTATCTCTCTGTATCACGTGG No data
1192875348_1192875358 27 Left 1192875348 X:75223645-75223667 CCCACAATCACTGCAGTTTCCCT No data
Right 1192875358 X:75223695-75223717 TATCACGTGGTCACTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192875348 Original CRISPR AGGGAAACTGCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr