ID: 1192880191

View in Genome Browser
Species Human (GRCh38)
Location X:75274928-75274950
Sequence GACAACTCCTTGGCCATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192880186_1192880191 6 Left 1192880186 X:75274899-75274921 CCTCTGGGCTCTTTGTCTCTCCC 0: 1
1: 0
2: 5
3: 49
4: 587
Right 1192880191 X:75274928-75274950 GACAACTCCTTGGCCATTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192880191 Original CRISPR GACAACTCCTTGGCCATTCC AGG Intronic
900032227 1:380387-380409 GACCACTGCTGGGGCATTCCTGG - Intergenic
900052779 1:608573-608595 GACCACTGCTGGGGCATTCCTGG - Intergenic
901076050 1:6555333-6555355 GGCCACTCCTTGGCCATGCCAGG + Exonic
901153765 1:7122067-7122089 GAACACTCCATGGCCTTTCCCGG - Intronic
901319461 1:8330649-8330671 GACAGCTACCTGGCCATCCCTGG + Exonic
903620600 1:24695483-24695505 GACAACTTCTTTGCCATACATGG - Intergenic
905236501 1:36553837-36553859 GACAAGTCCTTTGCCATCTCAGG + Intergenic
907862503 1:58367167-58367189 GACAGCTCCTTGTCCATGCTAGG - Intronic
907862780 1:58369606-58369628 GACAGCTCCTTGCCCATGCTAGG - Intronic
908388227 1:63662639-63662661 GTCATCTCCTTGGCCCTTCAAGG + Intergenic
909474106 1:76062838-76062860 GAGAACTCCTTTCCCTTTCCAGG - Intergenic
909837867 1:80280166-80280188 GACAAATCCTTAACCATTCATGG - Intergenic
912444136 1:109721611-109721633 GCCAACTCCCTGGCCCTCCCGGG - Intronic
913314954 1:117541721-117541743 GAATACTCCTTGGCCTCTCCAGG + Intergenic
916117537 1:161499877-161499899 AACAACTCCTGGAACATTCCAGG + Intergenic
917844729 1:179011135-179011157 GACACCCCCTTTCCCATTCCTGG - Intergenic
918067727 1:181112896-181112918 GTCAACCCCATGGCCTTTCCCGG + Intergenic
921068761 1:211641954-211641976 GACAACACTTATGCCATTCCTGG - Intergenic
922903302 1:229155030-229155052 GACAACTCCTTGGGCTTCCTGGG - Intergenic
1063971680 10:11385524-11385546 GACAAATCCTACCCCATTCCAGG + Intergenic
1066044894 10:31586410-31586432 GCCACCTGCTTGGCTATTCCTGG - Intergenic
1067791867 10:49294367-49294389 GACAATACCTTGGACATTCTGGG - Intergenic
1069756608 10:70777528-70777550 GACCCCTCCTTGGGCATCCCCGG + Intronic
1072743032 10:97921729-97921751 GCCACCACCTTGGCCATCCCTGG - Intronic
1073737777 10:106369414-106369436 TCCAACTTCATGGCCATTCCAGG + Intergenic
1074325961 10:112451187-112451209 GACAATTGCTTGGCCTTTCTAGG + Intronic
1075847872 10:125560624-125560646 AACAACTCCTCAGCCATTCAAGG - Intergenic
1076794315 10:132791326-132791348 GAAACCTCCTTGGCCAGGCCAGG - Intergenic
1077576237 11:3386143-3386165 GACAACTACGTGGCCATTCTAGG + Intergenic
1078137336 11:8662212-8662234 GACTACTCTTTGCTCATTCCAGG - Intronic
1079105866 11:17572109-17572131 CACAACTTTTTGGCAATTCCTGG + Exonic
1080610627 11:33900807-33900829 GACAACTCATTGCCAACTCCTGG + Intergenic
1084942364 11:72619838-72619860 GACAAGTCTTTGGACCTTCCTGG + Intronic
1091488017 12:908478-908500 GAGAACTTCCTTGCCATTCCAGG - Exonic
1092145684 12:6212950-6212972 GACAACTCCTTGCCCGCTCCTGG - Intronic
1093423882 12:19005763-19005785 TAAAACTCCCTAGCCATTCCTGG - Intergenic
1096451799 12:51749073-51749095 GCCAAATACTGGGCCATTCCAGG + Intronic
1098208463 12:68137179-68137201 GAGAAAGACTTGGCCATTCCTGG - Intergenic
1099139254 12:78950650-78950672 GATGATTCCTTGGTCATTCCAGG + Intronic
1100508336 12:95243080-95243102 GAAAACTCCATGGCCAGGCCTGG + Intronic
1101292733 12:103388192-103388214 GCCATCTGCTAGGCCATTCCTGG + Intronic
1101720428 12:107346008-107346030 GACAAATCCATGGACCTTCCTGG - Intronic
1102439288 12:112949035-112949057 GACAGGTCCAAGGCCATTCCCGG - Exonic
1102609981 12:114103378-114103400 GAAAATTCCTGGACCATTCCAGG + Intergenic
1104141677 12:125993292-125993314 GCCAACCCCTTGGCCATCCATGG - Intergenic
1104933103 12:132350798-132350820 GACAAGTCATGGGCCATTTCTGG - Intergenic
1107259485 13:38473198-38473220 GACAACTCCACTGCCATTTCTGG + Intergenic
1112324396 13:98433784-98433806 ACCACCTCCTTGGCCTTTCCTGG + Intronic
1115283014 14:31685923-31685945 GTGAATTCCTTGGCCATACCTGG - Intronic
1117228356 14:53687454-53687476 GGCAACTCCCTGACCCTTCCAGG - Intergenic
1117969424 14:61237415-61237437 GAGAACTCCTTTCCCTTTCCAGG + Intronic
1118096837 14:62546619-62546641 TACAATTCCTGGGCCAGTCCTGG + Intergenic
1124199466 15:27665949-27665971 GATCTCTCCTTGGCCAGTCCGGG - Intergenic
1127279779 15:57479076-57479098 AACAACTCCTTGCACCTTCCTGG - Intronic
1128393800 15:67202491-67202513 GACAACCTCCAGGCCATTCCTGG - Exonic
1136142824 16:28298217-28298239 CACAATTGCTTGGCCATACCTGG + Intronic
1137282939 16:46993328-46993350 GACAACACCTTGGCCAGACATGG + Intergenic
1141628309 16:85273166-85273188 GCCAACTACTTGGCCTCTCCGGG + Intergenic
1144288884 17:13806537-13806559 TATAACTCCTGGGCCATTTCTGG + Intergenic
1149354364 17:55824732-55824754 GAGAACTTCCAGGCCATTCCTGG - Intronic
1149579864 17:57742100-57742122 GACATTTCTTTGGCCATACCTGG - Intergenic
1151619561 17:75237668-75237690 CATCACTCCGTGGCCATTCCAGG + Exonic
1151842030 17:76625760-76625782 AACAGCTCCTGGGCTATTCCTGG - Intronic
1153904643 18:9650445-9650467 GCCAACTCCTTTGCCGTCCCTGG + Intergenic
1154074911 18:11190691-11190713 AAAAACTCCTTGGCCATACAGGG + Intergenic
1155244612 18:23895146-23895168 GACAACCCCTGAGCCTTTCCAGG - Intronic
1156476256 18:37407360-37407382 GGCACCTGCCTGGCCATTCCTGG + Intronic
1160425700 18:78777791-78777813 CCCAAGTCCTTGGTCATTCCAGG - Intergenic
1160587813 18:79922451-79922473 GACCACTCCTAGGACATTCTGGG + Intronic
1162964252 19:14148586-14148608 GACAGTTCCATGGCCCTTCCCGG - Exonic
931087646 2:58851299-58851321 GGCAACTCATAGGCCCTTCCAGG - Intergenic
931818938 2:65932380-65932402 GGCTTCTCCTTGGCCATACCAGG + Intergenic
946855494 2:223945566-223945588 GACAATTCCTTGTCCCCTCCAGG - Intergenic
1170092948 20:12612510-12612532 GACAACTCATAGGCCAAACCTGG + Intergenic
1170443093 20:16398414-16398436 CACACCTCCTTAGCCCTTCCTGG - Intronic
1171023416 20:21607658-21607680 GACAGGTTCTTGGCCATCCCAGG + Intergenic
1171978058 20:31607818-31607840 GACAAGTTCTTTGTCATTCCTGG - Intergenic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1174013681 20:47470942-47470964 CCAAACTCCTTGGTCATTCCTGG - Intergenic
1175009622 20:55722007-55722029 GGCTACTCCTGAGCCATTCCTGG + Intergenic
1175962424 20:62643724-62643746 GACAGCTCCTTGGCCTTAGCCGG + Intronic
1181914636 22:26269857-26269879 GACAACTCATTGGCCATAGCTGG - Intronic
1183298330 22:37045343-37045365 AAAAACTCCTGGGCCATTCTAGG + Intergenic
949240047 3:1859970-1859992 GACAAGTACTTGGCCACACCTGG + Intergenic
950090612 3:10291736-10291758 GACAACTCATTGGCCCTTAGGGG - Intronic
950195578 3:11006986-11007008 AACCACTCCTGGTCCATTCCAGG - Intronic
953908132 3:46878602-46878624 GAAAACCCCTTGGCCAGACCAGG - Intronic
955125379 3:56105790-56105812 GACATCTCCTTGGCTCTTCCTGG - Intronic
958868150 3:99525325-99525347 GAGGAGTCCTTGGCCACTCCAGG - Intergenic
962514901 3:136141173-136141195 TGCAACTCCTTGTCCATTACTGG - Intronic
965014643 3:163140908-163140930 TACAATTCCTGGGCAATTCCTGG - Intergenic
967307138 3:188069874-188069896 GACATACCCTTGCCCATTCCTGG - Intergenic
970578272 4:17448673-17448695 GACAAATAATTGGCCATTCCAGG + Intergenic
972444438 4:39129956-39129978 AACAACTCCTGTGGCATTCCAGG - Intergenic
972623845 4:40776906-40776928 GACAGCTCCTAGGCCAGGCCTGG - Intronic
975059387 4:69978634-69978656 GACCACGCCTGGGCCCTTCCTGG + Intergenic
975106540 4:70573895-70573917 GACTACACCATGGGCATTCCTGG + Intergenic
977138927 4:93341732-93341754 CACAACTCCTAGGCAAATCCAGG - Intronic
981084247 4:140666886-140666908 GACAAGGCCTTGGCCAGTCCAGG - Intronic
981975629 4:150724094-150724116 GACAGCACTTTGGACATTCCCGG + Intronic
982211625 4:153041422-153041444 GCCAACTCCTTGGGATTTCCTGG - Intergenic
982545547 4:156728142-156728164 GTCACATCCTTTGCCATTCCTGG - Intergenic
987644387 5:20649303-20649325 GACAACAGCTTGGCACTTCCAGG - Intergenic
987815634 5:22897973-22897995 GATATTTCCTTGGCCATTTCTGG - Intergenic
994762178 5:103868543-103868565 CATAACTGCTTGGCCATTCTTGG - Intergenic
996833471 5:127765861-127765883 GACAACTCCTTTTTCATTCACGG - Intergenic
999045140 5:148459148-148459170 GCCAACTCCATGCCCATGCCTGG - Intronic
1000432437 5:161166738-161166760 GAAAACACTTTGGCCATTCCGGG - Intergenic
1002741593 5:181438481-181438503 GACCACTGCTGGGGCATTCCTGG + Intergenic
1004200656 6:13544635-13544657 GACAACTGCCTGGCCATTGTCGG - Intergenic
1007784528 6:44272103-44272125 AACAACTCCTGGGCCAACCCTGG + Intronic
1012493841 6:99812635-99812657 AACCACTCCTTGGCAACTCCTGG + Intergenic
1013934024 6:115571622-115571644 GACAACTCCTGGTCCATTCTTGG + Intergenic
1016979642 6:149842695-149842717 GACAATTGCTTGGCTATTCTGGG - Intronic
1019246731 6:170714246-170714268 GACCACTGCTGGGGCATTCCTGG + Intergenic
1019507186 7:1397665-1397687 GAAAACAGCCTGGCCATTCCTGG + Intergenic
1022172636 7:27844446-27844468 GGGAACTCCTTCCCCATTCCTGG + Intronic
1023327142 7:39072562-39072584 GACAACACGTTAGCCATTCTAGG + Intronic
1035082403 7:156227874-156227896 GACCACTCCTGGGCTGTTCCTGG - Intergenic
1035501411 8:93715-93737 GACCACTGCTGGGGCATTCCTGG - Intergenic
1037520340 8:19674790-19674812 GACAACTTCTTCGCGTTTCCAGG - Intronic
1043572902 8:81625414-81625436 GTCATGTCATTGGCCATTCCTGG - Intergenic
1045412798 8:101935719-101935741 GACAACTCTTTTGCCATTAAGGG + Intronic
1048754778 8:137726963-137726985 GCCAGCTCCTTGACAATTCCAGG - Intergenic
1048954502 8:139524648-139524670 ACCAACTCCTAGCCCATTCCTGG - Intergenic
1049257887 8:141623597-141623619 CACAGCACCTTGTCCATTCCAGG - Intergenic
1049377165 8:142294803-142294825 GACACCTCCTCGCCCATGCCAGG + Intronic
1056519473 9:87386899-87386921 CACATCTCCTTGGCCTTTTCAGG - Intergenic
1061701596 9:132420353-132420375 GAAAACACCTTGCACATTCCAGG - Intronic
1203607504 Un_KI270748v1:69697-69719 GACCACTGCTGGGGCATTCCTGG + Intergenic
1189910375 X:45804927-45804949 GACAATTCCATGGCAATTCATGG - Intergenic
1189948420 X:46203839-46203861 GACAGCACCTTGGAGATTCCAGG - Intergenic
1191978999 X:66904821-66904843 GACAACACTTTGGCCCTTTCAGG + Intergenic
1192757748 X:74064289-74064311 GACAACTGCCTGTCTATTCCTGG + Intergenic
1192880191 X:75274928-75274950 GACAACTCCTTGGCCATTCCAGG + Intronic
1193540013 X:82759710-82759732 GACCAATCCTTGGCCAAGCCAGG + Intergenic
1195383509 X:104292286-104292308 GACATCTCTTTACCCATTCCTGG - Intergenic
1196441941 X:115726527-115726549 GCTAACTCCCTGGCCATTGCCGG + Intergenic
1196442602 X:115729497-115729519 GCTAACTCCCTGGCCATTGCCGG + Intergenic
1196442956 X:115731408-115731430 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196443621 X:115734376-115734398 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196444402 X:115737928-115737950 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196445947 X:115846303-115846325 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196446618 X:115849284-115849306 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196447286 X:115852267-115852289 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196447957 X:115855246-115855268 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196448626 X:115858237-115858259 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196449297 X:115861228-115861250 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196449966 X:115864211-115864233 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196450636 X:115867196-115867218 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196451307 X:115870175-115870197 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196451978 X:115873162-115873184 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196452648 X:115876131-115876153 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196453318 X:115879124-115879146 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196453988 X:115882133-115882155 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196454654 X:115885122-115885144 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196455068 X:115887204-115887226 GCTAACTCCCTGGCCATTGCCGG - Intergenic
1196683243 X:118489985-118490007 GACAAAGCCTTGGCAATTCAGGG + Intergenic
1198731069 X:139729846-139729868 GACACCTCCTTTGCCATGGCTGG + Intronic
1201796629 Y:17903405-17903427 GACAGCTCCTGGCCCATTGCTGG - Intergenic
1201804926 Y:18002580-18002602 GACAGCTCCTGGCCCATTGCTGG + Intergenic