ID: 1192894313

View in Genome Browser
Species Human (GRCh38)
Location X:75424638-75424660
Sequence ATATTCAGTCTTACCTAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192894310_1192894313 14 Left 1192894310 X:75424601-75424623 CCTCTGATACACATTAATATGTT 0: 1
1: 0
2: 0
3: 15
4: 231
Right 1192894313 X:75424638-75424660 ATATTCAGTCTTACCTAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 115
1192894309_1192894313 15 Left 1192894309 X:75424600-75424622 CCCTCTGATACACATTAATATGT 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1192894313 X:75424638-75424660 ATATTCAGTCTTACCTAAGGTGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192894313 Original CRISPR ATATTCAGTCTTACCTAAGG TGG Exonic