ID: 1192896553

View in Genome Browser
Species Human (GRCh38)
Location X:75448319-75448341
Sequence AGGGAGTACAGAATGGATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 1, 2: 4, 3: 76, 4: 483}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192896546_1192896553 9 Left 1192896546 X:75448287-75448309 CCAGTACCAGCTGAGGTGCTTGC 0: 1
1: 2
2: 43
3: 206
4: 344
Right 1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG 0: 1
1: 1
2: 4
3: 76
4: 483
1192896544_1192896553 26 Left 1192896544 X:75448270-75448292 CCACGTCAGGTAAAAAACCAGTA 0: 1
1: 0
2: 1
3: 7
4: 80
Right 1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG 0: 1
1: 1
2: 4
3: 76
4: 483
1192896547_1192896553 3 Left 1192896547 X:75448293-75448315 CCAGCTGAGGTGCTTGCTAAAGG 0: 8
1: 240
2: 287
3: 188
4: 266
Right 1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG 0: 1
1: 1
2: 4
3: 76
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192896553 Original CRISPR AGGGAGTACAGAATGGATGG TGG Intronic
900110250 1:1002147-1002169 AGGGAGTTCGGGATGGAAGGAGG + Intergenic
900399492 1:2467196-2467218 AGGGAGGACAGGATGAACGGTGG + Intronic
901728575 1:11261951-11261973 AGGAAGTTAAGATTGGATGGGGG + Intronic
902346319 1:15820753-15820775 TGGGAGTAGGGAATGGATGTGGG - Intergenic
902746576 1:18478599-18478621 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
902746581 1:18478615-18478637 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
903345810 1:22683634-22683656 AGGGAGAACAGCATGGCAGGGGG - Intergenic
903874834 1:26466719-26466741 TGGCAGAACAGAAAGGATGGGGG - Intronic
904498456 1:30900811-30900833 GGGGAGGGCAGGATGGATGGGGG + Intronic
904922530 1:34020222-34020244 AAGGGGAACAGAATGTATGGAGG + Intronic
905035136 1:34913140-34913162 AGGGGGAACAGAAAGGAAGGAGG + Intronic
905893468 1:41531075-41531097 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893480 1:41531125-41531147 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893491 1:41531175-41531197 AGGGAGGACAGGAGAGATGGAGG + Intronic
905893499 1:41531224-41531246 AGGGAGAACAGGAGAGATGGAGG + Intronic
905893737 1:41532306-41532328 AGGGAGGACAGAAGAGATGGAGG + Intronic
906124880 1:43421653-43421675 AGGGAGTACACAGTTCATGGTGG - Intronic
906366303 1:45212968-45212990 GGGGAATTCAGAATGGATAGTGG - Intronic
907262479 1:53230347-53230369 AGGGAGAACAGAATGGGAGATGG - Intronic
908260418 1:62335915-62335937 AGTGTGTTCACAATGGATGGAGG + Intergenic
908278846 1:62507139-62507161 ACAATGTACAGAATGGATGGTGG + Intronic
908361119 1:63368970-63368992 GGGGAGGAAAGAAGGGATGGTGG - Intronic
908552971 1:65228374-65228396 AGGGAGGGAAGGATGGATGGAGG - Exonic
910141775 1:84034025-84034047 AGGGAATACAGAATGAGTAGTGG + Intergenic
910466922 1:87509943-87509965 AGGAAGTGCAGAATGGATGATGG + Intergenic
910909894 1:92222486-92222508 TGGGATTACAGAAGGGAAGGAGG - Intronic
910948495 1:92618699-92618721 AGGGAATACAGAATGGGTAACGG + Intronic
911016035 1:93333706-93333728 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
911058865 1:93730846-93730868 AGAGAGTACAGAATGGAAAGTGG + Intronic
911112206 1:94201464-94201486 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
911752626 1:101515033-101515055 ATGGAGTACAGCCTGTATGGAGG - Intergenic
913666309 1:121051873-121051895 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
914656608 1:149747518-149747540 AGGGAGGAAAGGATGGAGGGAGG + Intergenic
915482241 1:156194760-156194782 AGGGAGAACAGAAGGAATGGAGG + Intronic
916386050 1:164271718-164271740 AGGAAGGAAAGAAGGGATGGAGG + Intergenic
918069070 1:181121814-181121836 AGGGAGTAGACAAGGGATAGGGG + Intergenic
918148320 1:181777268-181777290 AGGGGGACCAGAATGGATAGAGG - Intronic
918201608 1:182272532-182272554 GGGGAGAACAGACTGGAAGGAGG + Intergenic
918556157 1:185801791-185801813 AGGGAGTTAAGGATGGCTGGAGG + Intronic
919353787 1:196495480-196495502 AGGGAGGAAGGAATGGAGGGAGG - Intronic
919470836 1:197977324-197977346 AGGGAGTACAAAATGGAAACAGG + Intergenic
919938153 1:202268492-202268514 TTGGAGTACAGAATGGAGGGTGG - Intronic
920658736 1:207897423-207897445 AGGGTGTTCAGAAGGGATGGAGG + Intronic
920679533 1:208062043-208062065 AGGGAGGGCAGGATGGATGAAGG + Intronic
922956383 1:229604734-229604756 AGGGAATACAGAATGGGTAGTGG + Intronic
923925945 1:238627836-238627858 AGAGAATACAGAATGGGTAGTGG - Intergenic
924593561 1:245426207-245426229 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
924866601 1:247989114-247989136 AGGCAAAAGAGAATGGATGGTGG + Intronic
1063529663 10:6819232-6819254 AGGGAGAACAGAACGGTGGGAGG - Intergenic
1063762511 10:9096252-9096274 AGAGAGTGGAGAATGGAAGGGGG - Intergenic
1064121462 10:12623196-12623218 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1064121508 10:12623328-12623350 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1064389294 10:14927591-14927613 AGGGAGGGAAGAAGGGATGGAGG + Intronic
1065453760 10:25884704-25884726 AGGGAATACAGAATGGGTAGTGG + Intergenic
1065779188 10:29150996-29151018 AGGCACTATAGGATGGATGGGGG + Intergenic
1065953932 10:30677044-30677066 AGCGAGTACAGCGAGGATGGAGG - Intergenic
1066051202 10:31637459-31637481 AGGGAAAACAGAATGGGTAGTGG - Intergenic
1066957887 10:42190002-42190024 AGGGAATACAGAATGAATAGTGG + Intergenic
1067285124 10:44902259-44902281 AGGGAGGAGAGGAGGGATGGGGG + Intergenic
1067666319 10:48282618-48282640 AGGGAATACAGAATGAGTAGTGG - Intergenic
1068233517 10:54202355-54202377 AGGGAATAAAGGATGGATAGAGG + Intronic
1069670123 10:70195330-70195352 AGGGAGTAAAGAGTGGGAGGGGG - Intergenic
1069967734 10:72135334-72135356 AGGGAGTAGAGTGTGAATGGGGG + Intronic
1070499300 10:77055463-77055485 AGGGAGGAAGGAATGGATGGAGG - Intronic
1070725777 10:78788258-78788280 AGAGAAGACAGAATGGATGTTGG - Intergenic
1070986994 10:80697739-80697761 AGGAAGTAAAGAAGGGAGGGAGG - Intergenic
1071964769 10:90841532-90841554 AGGTATTTCAGAATGGAAGGGGG - Intronic
1072171625 10:92868784-92868806 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
1072208352 10:93224224-93224246 ATGGTGTACAGAGTGGATGCTGG + Intergenic
1072253545 10:93600553-93600575 AGGGAGCACCGAATGGGTGGAGG - Intronic
1073586933 10:104719492-104719514 AGGTTGTGGAGAATGGATGGTGG + Intronic
1073931862 10:108585619-108585641 AAGTAGTACAGAAAGGATGTTGG + Intergenic
1074191334 10:111140059-111140081 TGGGAGTACAGAATAGAGGATGG - Intergenic
1075266320 10:121002099-121002121 AAGGAGAACAGAAGGGAGGGAGG - Intergenic
1075427261 10:122351446-122351468 AGGGAGGACAGGCAGGATGGCGG - Intergenic
1075619655 10:123916447-123916469 AAGGAGCACAGAGTGAATGGGGG - Intronic
1075672040 10:124269454-124269476 AGGGAAGACAGCATGGAAGGAGG - Intergenic
1075672124 10:124270037-124270059 AGGGAAGACAGCATGGAAGGAGG - Intergenic
1077231288 11:1459169-1459191 CTGGAGTACAGAATGGAGAGAGG - Intronic
1077310299 11:1885717-1885739 AGTGAGTACTGGGTGGATGGAGG - Intronic
1077310312 11:1885812-1885834 AAGGAGTAAAGTATGGATGGAGG - Intronic
1077347916 11:2072891-2072913 GGGGAGTGCAGACTGGGTGGAGG - Intergenic
1077401652 11:2361150-2361172 AGGGACTACAGAATGGGCAGTGG + Intergenic
1077908586 11:6555171-6555193 AGGGAGGAGAGGAGGGATGGAGG - Intronic
1077931279 11:6735566-6735588 AGAGAGTACAGAATGAAAAGAGG - Intergenic
1079128999 11:17736665-17736687 AGGGAGTTCAGAATCGAAAGGGG + Intronic
1079501522 11:21105932-21105954 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
1080285772 11:30609575-30609597 AGGGAGTAGGGATTGGATGGAGG - Intergenic
1080895622 11:36446877-36446899 AGAAAGTAGAGAAAGGATGGTGG - Intronic
1080928669 11:36784838-36784860 AGGGAGAAAATAATGGAGGGAGG - Intergenic
1081355174 11:42103693-42103715 AGGAAGTAAAGAAGGGAGGGAGG - Intergenic
1082190735 11:49240492-49240514 AGGGAGCACAGTATGGAAAGAGG + Intergenic
1083094151 11:60232852-60232874 AGGGAGTAGAGAGTAGATAGCGG - Intronic
1084117352 11:67050013-67050035 AGGGAGCTCAGGCTGGATGGAGG + Exonic
1084470430 11:69356226-69356248 AGGGAGGAAAGAAGGGAGGGAGG + Intronic
1085071587 11:73551292-73551314 AGGGAGGACAGATTTGGTGGAGG + Intronic
1085868870 11:80326500-80326522 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
1086675384 11:89600449-89600471 AGGGAGCACAGTATGGAAAGAGG - Intergenic
1087021372 11:93606814-93606836 AGGGAATACAGAATAAGTGGTGG - Intergenic
1087271294 11:96114694-96114716 AAGGAGTTCAGAAAGGAGGGAGG - Intronic
1087712992 11:101575908-101575930 AGGGAGAAGAGAAGGAATGGGGG + Intronic
1088141837 11:106626133-106626155 TGAGATTACAGAATGAATGGCGG - Intergenic
1088407334 11:109496695-109496717 AGGTAATACAGAATGGGTAGTGG - Intergenic
1089307338 11:117535001-117535023 AGGGAGGAAAGAAAGGAGGGAGG - Intronic
1089473641 11:118740965-118740987 AGGAAATGCAGAATGGGTGGTGG - Intergenic
1089958753 11:122597233-122597255 AGGGAGGGCAGGAGGGATGGAGG + Intergenic
1090441026 11:126725778-126725800 AGGGACTACAGAGAGCATGGGGG + Intronic
1090453915 11:126830820-126830842 AGGGGTTACAAAATGCATGGAGG - Intronic
1090653386 11:128825124-128825146 AGGGAGAAAAGAATGGAAGAAGG - Intergenic
1090753750 11:129770637-129770659 CGGGAATACAGAATGGATAGTGG - Intergenic
1090844359 11:130518583-130518605 AGGGAGTGCTGATTGGTTGGGGG - Intergenic
1091931517 12:4399407-4399429 AGGGAAGACAGGAAGGATGGAGG + Intergenic
1092002352 12:5043437-5043459 AAGGATTACAGAAGGGAGGGGGG - Intergenic
1092097680 12:5857199-5857221 AGGCAGGGCAGAATGGATGTCGG - Intronic
1094567552 12:31613556-31613578 AGGGAGGGAAGGATGGATGGAGG + Intergenic
1096480068 12:51934224-51934246 AGGGAGTCCAGAGTGGCTGGAGG - Intergenic
1096756614 12:53804818-53804840 AGTGAAAACAGAATGGAAGGAGG - Intergenic
1096758086 12:53816844-53816866 AGGTATTGCTGAATGGATGGGGG - Intergenic
1096761191 12:53843414-53843436 AGGGACTACTGAATGGAATGCGG + Intergenic
1097134557 12:56840973-56840995 AGGGAGTGAAGGATGCATGGGGG - Intergenic
1097755315 12:63401125-63401147 AGGGAGTACAGTACAGATGTGGG + Intergenic
1098139682 12:67438827-67438849 AAGGAGTAAAGAATAGAGGGGGG - Intergenic
1098669176 12:73203121-73203143 AGGGAGAACATCATGGATGGTGG - Intergenic
1098807414 12:75036858-75036880 AAGGAATACAGAATGGGTGATGG + Intergenic
1099994939 12:89768443-89768465 AGGGAATACAGAATGGGTAGTGG - Intergenic
1100150395 12:91729627-91729649 AGGGAATACAGAATGGATGGTGG + Intergenic
1100370836 12:93967134-93967156 AGGGAGGAAGGGATGGATGGAGG - Intergenic
1100370867 12:93967230-93967252 AGGGAGAAAAGGATGGAGGGAGG - Intergenic
1100412703 12:94337861-94337883 AGGGAGGAGAGAATGGATGAAGG + Intronic
1100470480 12:94888408-94888430 AGGCAGTAGAGAAGGGGTGGAGG - Intergenic
1101100190 12:101383738-101383760 AGGGAGGACAGAAAGGAAGAAGG - Intronic
1101663984 12:106793061-106793083 AGGAAGGGCAGAATGGAAGGAGG - Intronic
1102034305 12:109762052-109762074 TTGGAGTACAGATTGGAGGGAGG - Intronic
1102573861 12:113843859-113843881 AGGGAGGACAGCATGGCTGGAGG - Intronic
1102756591 12:115346515-115346537 AGGAAGGAAAGAATGGAGGGAGG + Intergenic
1103030251 12:117606776-117606798 AGGGAGGAAAGAAGGGATGAAGG - Intronic
1103176723 12:118870580-118870602 GGGAAGTACAGGGTGGATGGAGG + Intergenic
1103729514 12:123017911-123017933 AGGGAGGAAGGGATGGATGGAGG - Intronic
1104185141 12:126423414-126423436 AGGGAATACAGAATGGGTAATGG - Intergenic
1105766617 13:23566392-23566414 AGGGAGTCCAGAAGGGCAGGGGG + Intergenic
1108569312 13:51733592-51733614 ACTGGGAACAGAATGGATGGAGG + Intronic
1109955293 13:69557718-69557740 AGGGATTATAGAATGGGTAGTGG + Intergenic
1110012096 13:70349434-70349456 AGGGAGGAAAAAAGGGATGGAGG + Intergenic
1110235113 13:73209686-73209708 ATGGAGAACACATTGGATGGAGG - Intergenic
1110325771 13:74213622-74213644 AGGGAGGAAAGAAGGGAGGGAGG - Intergenic
1110833866 13:80062654-80062676 AGGGAATCCAGAATGGGTAGTGG - Intergenic
1110912455 13:80981261-80981283 AGGGAGGAAGGAAGGGATGGAGG + Intergenic
1111695437 13:91617639-91617661 AGGGAGAAAAGAAAGGAGGGAGG - Intronic
1111887616 13:94042264-94042286 AGGGTGTACAGGAAGTATGGTGG - Intronic
1112194716 13:97213926-97213948 AGGGAGTATGGAATGGACGTGGG - Intergenic
1112474717 13:99721011-99721033 GGGAACTACAGAATGGATGCGGG - Intronic
1112651117 13:101399662-101399684 AGGGAGGTCAGAAAGAATGGGGG + Intronic
1113725173 13:112593120-112593142 AGTGAGATCAGAATGGATGCTGG + Intergenic
1114428647 14:22641497-22641519 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
1114965411 14:27953742-27953764 AGGTAATACAGAATGGATAGTGG - Intergenic
1115035826 14:28855337-28855359 AAGGTGTAATGAATGGATGGTGG - Intergenic
1117881571 14:60317904-60317926 AGGGAGGAAAGAAGGGATGAAGG + Intergenic
1119080174 14:71685393-71685415 ATGGAGTACAAAATGAATGAAGG + Exonic
1119236333 14:73022810-73022832 TGGGAGTACAGAATGACTAGGGG - Intronic
1120063617 14:80014120-80014142 AGAGAATATAGAATGGATAGTGG + Intergenic
1120575487 14:86175677-86175699 AGGGAGGAAAGAAGGGAAGGAGG + Intergenic
1120784261 14:88516636-88516658 AGGGAGTACAGAGGAGAGGGAGG - Intronic
1202935225 14_KI270725v1_random:81774-81796 AGGGAATACAGAATGAATAGTGG - Intergenic
1123917701 15:25049003-25049025 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
1124001937 15:25767326-25767348 AGGAAGCAGAGGATGGATGGAGG + Intronic
1124217780 15:27823332-27823354 AGGAAGGAAAGAATGGAGGGAGG + Intronic
1125989473 15:44092244-44092266 AGCTAGAACAGAAAGGATGGAGG - Intronic
1126579576 15:50230639-50230661 AGAGGGGACAGAATGGAAGGGGG + Intronic
1126851445 15:52799332-52799354 AGGAAGAAAAGAATGGAGGGAGG - Intergenic
1128271214 15:66311558-66311580 TGGTAGTAGAGAATGAATGGTGG + Intronic
1128701339 15:69806711-69806733 AGTGAGTAAAGAATGGAAGGAGG - Intergenic
1130699313 15:86163039-86163061 AGGAAGTACAGAATTTAGGGAGG - Intronic
1130966942 15:88705057-88705079 AGGGAGGTCAGCATGGATTGAGG + Intergenic
1130991340 15:88877695-88877717 AGGGAGACCAGCCTGGATGGCGG + Exonic
1131058345 15:89389751-89389773 AGGGAGTAGAGAAGGGTGGGGGG - Intergenic
1131541241 15:93277168-93277190 AGAGAGTACAGTGTGGAAGGAGG + Intergenic
1131925902 15:97383457-97383479 AGGGAGAAAGGAATGGAGGGAGG + Intergenic
1133711717 16:8408100-8408122 AGGGAGAAAGGAAAGGATGGAGG - Intergenic
1136045267 16:27610203-27610225 AGGGAGGACAGAAGGCAGGGAGG + Intronic
1139013950 16:62667257-62667279 AGGAAGAACAGAAAGGAGGGAGG + Intergenic
1139025221 16:62808326-62808348 AGGGAGTTCAGAATGAATCAAGG - Intergenic
1139227591 16:65248224-65248246 CAGAAGTACAGAATGTATGGAGG - Intergenic
1141823262 16:86462396-86462418 AGGGAGTGCAGGAGAGATGGAGG - Intergenic
1142220111 16:88850126-88850148 GGAGAGTACAGAATGGCAGGTGG + Intronic
1143141155 17:4742499-4742521 AAGGAGGTCAGAATGGTTGGGGG + Intronic
1143974356 17:10819260-10819282 AGGGAGGACAGAATGCACAGAGG - Intergenic
1144919100 17:18748751-18748773 AGGGACTAGACAATGGATTGTGG - Intronic
1145043743 17:19596067-19596089 AGTGTGGACAGCATGGATGGGGG + Intergenic
1145692395 17:26755988-26756010 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1146058175 17:29591414-29591436 GGGGAGTTCAGGATGGATTGTGG - Intronic
1146154164 17:30506056-30506078 AGTGAGTTGGGAATGGATGGTGG - Intronic
1146174853 17:30659369-30659391 AGGGAAGAAAGAATGGATGAGGG + Intergenic
1146189236 17:30750234-30750256 AGGGTGAACAAAATGGATGAAGG + Intergenic
1146251473 17:31348385-31348407 AGGGAGGGAAGGATGGATGGAGG - Intronic
1146334125 17:31954537-31954559 AGGGTGAACAAAATGGATGAAGG + Intronic
1146348307 17:32075393-32075415 AGGGAAGAAAGAATGGATGAGGG + Intergenic
1146620729 17:34395147-34395169 AGGAAGAACAGATTTGATGGAGG + Intergenic
1147150126 17:38509674-38509696 ACGGAAAACAGAATGGAAGGGGG + Intronic
1148082272 17:44973848-44973870 ATGGTTTATAGAATGGATGGAGG - Intergenic
1148968275 17:51456311-51456333 AGGGAGAAAAGAGTTGATGGTGG + Intergenic
1151487056 17:74407638-74407660 AGGGAGGCCAGGCTGGATGGTGG + Intergenic
1153588918 18:6652715-6652737 AGGGAGTAGGAACTGGATGGGGG + Intergenic
1153927156 18:9844131-9844153 ATGGTGCATAGAATGGATGGAGG - Intronic
1154041455 18:10860012-10860034 AGGGAGGACAGACAGGAGGGAGG + Intronic
1155336737 18:24772853-24772875 AAGGAATACAGAATGGGTAGTGG - Intergenic
1155510954 18:26576335-26576357 AGGGAGTAGAATATGGATGATGG - Intronic
1155630525 18:27887488-27887510 AGGGAGTAAAGGAGGGAAGGAGG - Intergenic
1156114113 18:33766630-33766652 AAAGAGTACAGGATGGAAGGGGG - Intergenic
1157503446 18:48207873-48207895 AGGGAGTTCCGACTGGACGGAGG + Intronic
1157538937 18:48485311-48485333 AGGGAGTCCAGAATTGTTTGAGG - Intergenic
1158658003 18:59358804-59358826 AGAGAGAACAGAATGGGTGAGGG + Intronic
1160194127 18:76738972-76738994 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194134 18:76738992-76739014 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194147 18:76739024-76739046 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194164 18:76739064-76739086 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194176 18:76739100-76739122 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194188 18:76739136-76739158 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194197 18:76739160-76739182 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194204 18:76739180-76739202 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194213 18:76739204-76739226 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160194230 18:76739256-76739278 AGGGAGTACAGGAGGGAGGGAGG - Intergenic
1160344404 18:78121015-78121037 AGGCTGTACAGAAAGCATGGTGG - Intergenic
1161346837 19:3772346-3772368 AGGGAGGGCAGGGTGGATGGAGG + Intergenic
1161665697 19:5574866-5574888 AGGGAGAAAAGAAAGGAAGGAGG + Intergenic
1162183864 19:8889404-8889426 AGGGAGTGCAGAAGGGAAGCAGG + Intronic
1162987546 19:14280637-14280659 AGGGAAGAAAGAATGGATGAGGG - Intergenic
1163462280 19:17446244-17446266 AGGGGAAAGAGAATGGATGGTGG - Intronic
1163501187 19:17677281-17677303 TGGGAGTAGAGAATTAATGGAGG - Intronic
1164655443 19:29917803-29917825 AGGAAGGAAAGAAGGGATGGAGG + Intergenic
1165748601 19:38246250-38246272 AGAGAGAACAGGGTGGATGGAGG + Intronic
1166449511 19:42886221-42886243 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166460809 19:42986514-42986536 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166478104 19:43146504-43146526 AGGGAGAAGGGAATGCATGGTGG - Intronic
1166663998 19:44666209-44666231 AGGGAGGGAAGAATGGAGGGAGG + Intronic
1166821262 19:45581649-45581671 AGGAAATAATGAATGGATGGAGG + Intronic
1166912800 19:46172464-46172486 AGGGATTATGGAATGGATAGTGG + Intergenic
1167059490 19:47134767-47134789 AAGCAGTGAAGAATGGATGGGGG + Intronic
1167448574 19:49553989-49554011 AGGGAGGACATGAAGGATGGGGG + Intergenic
1167534991 19:50044276-50044298 ATGGAGAACTGGATGGATGGTGG + Intronic
1167552417 19:50170108-50170130 AGGGAGGAGAGAAGGGAGGGAGG - Intergenic
1168471870 19:56646630-56646652 AGGAAGTCAAGAATGGAAGGTGG + Intronic
925454940 2:4008049-4008071 AGGGAGGCAAGAATGGAGGGAGG + Intergenic
925456753 2:4022706-4022728 GGCGAGGACAGAATGGATGCAGG + Intergenic
925764077 2:7214192-7214214 AGGGAGAACAGAAGGCTTGGTGG + Intergenic
926459316 2:13109396-13109418 AGAAAGGACAGAATGGATGTGGG + Intergenic
927258731 2:21064346-21064368 AGGCAGTAGAGAAGGGTTGGAGG - Intergenic
927260230 2:21081118-21081140 AGGTAGTAGAGAATGGAGGAAGG + Intergenic
928180587 2:29065647-29065669 TGGGAGTGCAGAATGGAGGGTGG + Intronic
928398286 2:30959905-30959927 AGGGGGTTCAGAATGGGTGCAGG + Intronic
928502610 2:31912816-31912838 AAGAAGTACAAAATGAATGGTGG - Intronic
928786685 2:34895566-34895588 AGGGAGAAAAGAAAGGAGGGAGG - Intergenic
928921709 2:36534253-36534275 AAGGAGGAAAGAAAGGATGGAGG + Intronic
929342205 2:40834250-40834272 AGGGAGGACAGATGGGAAGGAGG - Intergenic
929386775 2:41417365-41417387 AAGGAATACAGAATGGGTGATGG - Intergenic
929937550 2:46304845-46304867 AGGAAGGAAAGAATGGATAGGGG + Intronic
930132782 2:47869638-47869660 AAAGAGTACAGAATGGGTAGTGG + Intronic
930163844 2:48184273-48184295 AGGGGCTACAGAAAGGATAGAGG - Intergenic
930740118 2:54823701-54823723 ACTGAGTACAGGATGGATGATGG - Intronic
931916590 2:66963146-66963168 AGGGCTGACAGAATGGCTGGGGG - Intergenic
931949394 2:67345543-67345565 AGGGAGTACAGAAGGGTCAGAGG - Intergenic
932453070 2:71828148-71828170 AGGGTGTAGAGCAGGGATGGAGG - Intergenic
933067656 2:77818451-77818473 AGGAAGGACAGAAGGGAGGGAGG - Intergenic
934306004 2:91822519-91822541 AGGGAATACAGAATGAATAGTGG + Intergenic
934327252 2:92030223-92030245 AGGGAATACAGAATGAATAGTGG - Intergenic
934465634 2:94260803-94260825 AGGGAATACAGAATAAATAGTGG - Intergenic
934683428 2:96303000-96303022 AGGTAGTTCAGAATGGAGGCTGG - Intronic
935068263 2:99670909-99670931 AATGAGTACAGAATGGAAGGGGG + Intronic
935254108 2:101293248-101293270 GGGGAGTAGAGATTGGAGGGTGG + Intronic
935782317 2:106519028-106519050 ATGGAGGAATGAATGGATGGAGG - Intergenic
936679778 2:114757085-114757107 AGGGAGTAAAGGAAGGAAGGAGG + Intronic
936982877 2:118280000-118280022 GGGGAGTGAAGAATGGGTGGGGG + Intergenic
937072213 2:119073136-119073158 AGGGAGCAGAGGAGGGATGGAGG + Intergenic
937569184 2:123334832-123334854 AGGGTGTTCAGTAGGGATGGTGG - Intergenic
937686428 2:124703134-124703156 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
937752799 2:125498241-125498263 AGGGTGTACAGAAAACATGGCGG + Intergenic
937784938 2:125885766-125885788 AGGGAATACAGAATGAGTAGTGG - Intergenic
937821760 2:126318348-126318370 GGGAAGTACAGAATTGATGGTGG + Intergenic
938204152 2:129402878-129402900 AGGGAATAGAGAATGGGTAGTGG + Intergenic
938229627 2:129647299-129647321 AGGGAGGCCAGAGAGGATGGTGG - Intergenic
938676929 2:133645977-133645999 AAGAAGGACAGAATGGATGTAGG + Intergenic
939782719 2:146468898-146468920 TGGGAGTGTAGAATGGATGAGGG - Intergenic
940291117 2:152078458-152078480 AGGAAGGAGAGAATGGATGTTGG - Intronic
941339360 2:164287162-164287184 AGGGAGAATAGAAGGGAGGGAGG + Intergenic
941387056 2:164866539-164866561 AGGGAATACAGAATGGGTAGTGG + Intergenic
941971875 2:171359351-171359373 AGGGAATAATGAATGGATGCTGG + Intronic
942439581 2:176019033-176019055 AGGAAGTAGAGAATGTATGTAGG + Intergenic
942817207 2:180065853-180065875 AGGGAGGGGAGAATTGATGGTGG + Intergenic
944580070 2:201124704-201124726 AGGGGGAACAGAATGGCTAGGGG + Intronic
945874514 2:215264291-215264313 AGGGAGGACAGGGTTGATGGTGG + Intergenic
946347497 2:219122906-219122928 GGGGAGTAAAGAGTGGATAGCGG + Intronic
946553012 2:220823621-220823643 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
946553038 2:220823698-220823720 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
946672495 2:222121227-222121249 AGGGAAGAAGGAATGGATGGAGG + Intergenic
947021545 2:225683011-225683033 AGGAAGAACAGAATGGGGGGGGG - Intergenic
947363906 2:229374239-229374261 AGGGAGTAAGGAAAGGAAGGGGG + Intronic
947965893 2:234281312-234281334 AGAGAATGCAGAATGGATGCTGG - Intergenic
1168863511 20:1063670-1063692 AGGGAGTAAAGAATAGAAGTAGG - Intergenic
1169014776 20:2282643-2282665 AGGGAGGCAAGAATGGATGCTGG + Intergenic
1169017956 20:2307017-2307039 AGGGAGGACAGAAAGGACAGAGG - Intronic
1169819361 20:9691466-9691488 AGGTGGTACAGACTGGATGGTGG - Intronic
1170744938 20:19090963-19090985 AGGGAGGAGAGAAGGGAAGGTGG + Intergenic
1170880956 20:20296192-20296214 AGGGAGGAGAGAAGGGAAGGAGG - Intronic
1172506920 20:35469736-35469758 AGGGAGTGCAGACGGGCTGGGGG + Intronic
1172983678 20:38964789-38964811 GTGGAGTAGAGAGTGGATGGAGG + Intronic
1173331613 20:42080264-42080286 AAGGGGTACAGAATGGTTGTGGG + Exonic
1173756420 20:45520788-45520810 AGGCAATACAGAATGGGTAGTGG - Intergenic
1174044419 20:47723384-47723406 AAGGAAGAGAGAATGGATGGAGG + Intronic
1174258955 20:49279116-49279138 AGCGGGTACAGAATGGATTTTGG + Intergenic
1174961794 20:55166125-55166147 AGGGAGGCAAGACTGGATGGAGG - Intergenic
1175278791 20:57788821-57788843 AGGAAGGACAGAAGGGAGGGAGG + Intergenic
1175615037 20:60390638-60390660 AGGAAGGAAGGAATGGATGGAGG - Intergenic
1176019331 20:62954503-62954525 AGGGAGTGCAGAGTGGTGGGAGG + Intronic
1176292273 21:5052572-5052594 AGGGAGGAATGGATGGATGGAGG - Intergenic
1176444832 21:6813218-6813240 CTGGAATACAGAATTGATGGAGG - Intergenic
1176596643 21:8704010-8704032 AGGGAATACAGAATGAATAGTGG - Intergenic
1176822997 21:13678253-13678275 CTGGAATACAGAATTGATGGAGG - Intergenic
1177162810 21:17566808-17566830 CTGGAATACAGAATTGATGGAGG - Exonic
1178063059 21:28873453-28873475 AGGGAATACAGAATAAATGGTGG - Exonic
1179046482 21:37849530-37849552 TGGGAGTGCAGAGTGGATGTTGG - Intronic
1179634140 21:42696647-42696669 TGGGAGGACAGAGTGGAGGGTGG - Intronic
1179864987 21:44211086-44211108 AGGGAGGAATGGATGGATGGAGG + Intergenic
1180279562 22:10681452-10681474 AGGGAATACAGAATGAATAGTGG - Intergenic
1180586775 22:16899982-16900004 AGGGAATACAGAATGAAAAGTGG - Intergenic
1180705517 22:17807648-17807670 AGGGAGTCCAGAATGGAAGTAGG - Intronic
1181330734 22:22088767-22088789 AGGGAACACAGACTGCATGGAGG - Intergenic
1181533904 22:23532075-23532097 AGGGATGACAGACAGGATGGAGG + Intergenic
1183146505 22:35997438-35997460 AGGGAGCAGAGAATGCATAGAGG - Intronic
1183182307 22:36268342-36268364 CGTGAGGACAGACTGGATGGGGG - Intergenic
1183352497 22:37342091-37342113 GGGGTGTAAAGAATGCATGGAGG - Intergenic
1183426432 22:37741887-37741909 AGGGAGATCAGGATGCATGGAGG + Intronic
1183498472 22:38163827-38163849 TGGGAGGACTGAATGGATGGAGG + Intronic
1183646989 22:39132674-39132696 AGGGGATGCAGAATGGAAGGAGG + Exonic
1184103375 22:42353416-42353438 AGGGAGGACAGGAAGGAGGGTGG + Intergenic
1184278091 22:43421719-43421741 AGGGAGAAACGGATGGATGGAGG - Intronic
1185313500 22:50169514-50169536 AGGGAGAACAGGACGGAGGGCGG + Intergenic
949445891 3:4133025-4133047 AGGGAATACAGAATGGGTATTGG + Intronic
949730841 3:7110965-7110987 GGGGAAGACAGAATGGGTGGAGG + Intronic
950037772 3:9899513-9899535 AGGGAGGAAAGAAGGGAGGGAGG - Intergenic
950320416 3:12047298-12047320 AGGGTGTGTAGATTGGATGGTGG + Intronic
951353406 3:21634235-21634257 AGGGAGAGCAGAAGGGAGGGAGG + Intronic
954076082 3:48182001-48182023 AGGGAAAACAGCATAGATGGTGG - Intronic
954927468 3:54248853-54248875 AGGGAATACAGAATGGGTAGTGG + Intronic
955161465 3:56468413-56468435 AGGGAGGAAAGAAGGGAAGGAGG + Intergenic
955334586 3:58074673-58074695 GGGGAGTAGAAAATGGATGTTGG + Intronic
955712975 3:61799743-61799765 AAGGAGTACAGTATGGTGGGGGG - Intronic
955930861 3:64055498-64055520 AGGAAGAACAGCATGGATGAAGG - Intergenic
956948951 3:74257842-74257864 AGGGAGAAAACAATGGATGTGGG - Intergenic
958017566 3:87958902-87958924 ATGGAGTACCAAATGCATGGTGG - Intergenic
958952216 3:100428950-100428972 AGGGAGTATGGATTGGAAGGGGG + Intronic
959446771 3:106450058-106450080 AGGGAGTGCTGAAGGGATGTAGG + Intergenic
960009049 3:112813346-112813368 AGAGAGGACAGCATGGATGAAGG - Intronic
960330321 3:116351628-116351650 GGAAACTACAGAATGGATGGCGG + Intronic
962290011 3:134127166-134127188 AGGGAGGAGAGAATGAATGGTGG + Intronic
962379274 3:134884086-134884108 ATGGAGGCCAGAATGGGTGGTGG - Intronic
962555889 3:136551047-136551069 AAGGAGTACAGTGTGGAAGGAGG - Intronic
963378974 3:144505318-144505340 AGGGGATACAGAATGGGTAGTGG - Intergenic
963420780 3:145058333-145058355 AGGGAATACAGAATGAACAGTGG + Intergenic
966752796 3:183338623-183338645 AGGAAGTACACAATGGACTGAGG - Intronic
967079912 3:186040235-186040257 TGAGAGTAAAGAATGGGTGGAGG + Intergenic
968362399 3:198156739-198156761 AAAGAGTAGAGAATGGAAGGTGG + Intergenic
968663687 4:1809613-1809635 AGGGAGAGCAGAGGGGATGGGGG - Intergenic
969481360 4:7448721-7448743 AGGAAGTACGGAAGGGAGGGAGG - Intronic
969507005 4:7594355-7594377 GGAAATTACAGAATGGATGGAGG + Intronic
970389993 4:15599213-15599235 AGGGAGTACTGAATGACTTGGGG - Intronic
970689947 4:18611522-18611544 AGGGAGGAAGGGATGGATGGAGG + Intergenic
971100744 4:23464458-23464480 AGGGAATACAGAATAGGTAGTGG - Intergenic
971566228 4:28145087-28145109 AGGGTGTACAGGAAGCATGGTGG + Intergenic
971571191 4:28213129-28213151 AGGGTGCTCAGAATGGATGGTGG + Intergenic
972295398 4:37732963-37732985 AGAGAGTACAGAATGAATGTTGG - Intergenic
972369444 4:38408863-38408885 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
972456087 4:39256797-39256819 ATGGAGAACAGGATGGATGAAGG - Intronic
972626142 4:40801050-40801072 AGGGAGGAAAGAAGGGAGGGAGG + Intronic
973256868 4:48122377-48122399 AGGGAGTTAAGAAAGGAGGGAGG - Intronic
977725983 4:100297581-100297603 AGGCAGAACAGAATGAATGTAGG - Intergenic
977794236 4:101143282-101143304 AGGGAGTAAATAATTGATGATGG - Intronic
978194575 4:105956219-105956241 AAGGAGTTCACAATGGCTGGAGG - Intronic
978286710 4:107086402-107086424 AGGAAGAAAAGAATGGAGGGAGG + Intronic
978485669 4:109251273-109251295 AGGGAATACAGAATGAGTGGTGG - Intronic
978594849 4:110366151-110366173 AGTGAGTACAGAGTGGATACAGG - Intronic
979036623 4:115727705-115727727 AGAGAGTGCAGAAAAGATGGCGG - Intergenic
980406429 4:132358297-132358319 AGGGATTAGAGACTGAATGGTGG + Intergenic
980822100 4:138030926-138030948 AGACAGTACAGAATGAAAGGGGG - Intergenic
982105275 4:152006452-152006474 AGGAAGAAAAGAATGGATGTTGG - Intergenic
982428699 4:155297640-155297662 AGGCTGTACAGAAAGCATGGTGG + Intergenic
982623063 4:157730925-157730947 AGGGAATACAGAATGGGTAGTGG - Intergenic
982772233 4:159407206-159407228 AGGGAATATAGAATGGTTAGTGG + Intergenic
983273662 4:165592092-165592114 AGGGAGGAGAGAAGGAATGGAGG - Intergenic
983352159 4:166603450-166603472 AGGAAGGACAGAATGGCTAGAGG - Intergenic
983691059 4:170469624-170469646 AGGGAGGGCAGAAGGGAGGGAGG - Intergenic
984264970 4:177487524-177487546 AGGGAATTTAGAATGGGTGGTGG - Intergenic
984409126 4:179372268-179372290 AGAGAGTACAAAATGGTAGGAGG - Intergenic
984538978 4:181013500-181013522 TGGGAAAACAGAATGGAAGGTGG + Intergenic
985198307 4:187456976-187456998 AGGGAGCCCAGAAGAGATGGAGG + Intergenic
985576315 5:675035-675057 GGGGGGTACAGTATGGCTGGGGG + Intronic
985819285 5:2148682-2148704 AGGGGGTACACAGAGGATGGGGG + Intergenic
985819918 5:2152827-2152849 AGGGAGAAAAGAAGGGAGGGAGG - Intergenic
986100877 5:4609946-4609968 AGGGAGTTCAGTAAGGCTGGAGG - Intergenic
986282052 5:6331331-6331353 AGGCTGTACAGAAAGCATGGTGG - Intergenic
986491858 5:8301012-8301034 AGGCTGTACAGAAGGGAAGGGGG + Intergenic
986500463 5:8393266-8393288 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
986531131 5:8738373-8738395 AGGGAATGCAGAATGGGTAGTGG - Intergenic
987490610 5:18576470-18576492 AGGGAATAGAGAATGCATGGTGG - Intergenic
987661427 5:20883243-20883265 AAGGAATACAGAATGGAAGAAGG - Intergenic
988732601 5:33988078-33988100 AGGGAGTAGAGAATGGATGTTGG - Exonic
988762158 5:34322082-34322104 AAGGAATACAGAATGGAAGAAGG + Intergenic
990317853 5:54601065-54601087 AGGGAGGACGGGAGGGATGGAGG - Intergenic
990822004 5:59851776-59851798 ACGCAGTACAGAATGGCAGGTGG + Intronic
990844993 5:60127395-60127417 ATGGAGAACAGATTGGATGAGGG + Intronic
990948435 5:61273427-61273449 AGAGTGTAGAGAATTGATGGGGG - Intergenic
991349702 5:65708307-65708329 TGGAAGTACAGAATGGCTTGTGG - Intronic
991603998 5:68382063-68382085 AAGGAGTTCAGCAGGGATGGGGG - Intergenic
992186412 5:74248949-74248971 AGGGAGGAAGGAATGGAGGGAGG + Intergenic
992978751 5:82143493-82143515 AGGAAGTCCAGACTGAATGGAGG + Intronic
997762420 5:136462640-136462662 TGGGAGTACAGAGTGGATGAGGG - Intergenic
997931779 5:138078383-138078405 AGGGAGTAGAGAGGGGGTGGAGG - Intergenic
998399550 5:141841438-141841460 AGGAAGTAAAGAAGGGAGGGAGG + Intergenic
999937944 5:156508298-156508320 AGGCAGCACAGAAAGAATGGAGG - Intronic
1000071556 5:157744537-157744559 AGGGTCTACAGGATTGATGGAGG + Intronic
1000724159 5:164747714-164747736 AGGGTGTTAAGAATGGGTGGAGG + Intergenic
1001318868 5:170663902-170663924 GGAGAGTATAGAAAGGATGGTGG - Intronic
1001877407 5:175213418-175213440 AGGAAGGACAGAAGGGAGGGAGG - Intergenic
1001877418 5:175213458-175213480 AGGAAGGACAGAAGGGAGGGAGG - Intergenic
1002379837 5:178818598-178818620 AGGGGATCCAGAATGGGTGGAGG + Intergenic
1002621409 5:180491200-180491222 AGAGAGAACAGGATGGAGGGTGG + Intergenic
1003023358 6:2530957-2530979 AGGGAATTTAGAATGGATAGAGG + Intergenic
1003265521 6:4562070-4562092 AGTGAGCAGAGAATGGATGTCGG + Intergenic
1003268557 6:4587980-4588002 AGGGAGAGCAGATAGGATGGAGG - Intergenic
1003565644 6:7219933-7219955 AGGGAGGAAGGAAGGGATGGAGG + Intronic
1004815032 6:19303507-19303529 AGGCAGCACAGAATGGAAAGAGG - Intergenic
1005464351 6:26097543-26097565 AAGGAATAAAGAATGGGTGGAGG + Exonic
1005714272 6:28532102-28532124 ATGGAGGACAGAAGGGATGGAGG + Intronic
1006875972 6:37296661-37296683 AGGGAGTAGAGAATGGAGAGAGG - Intronic
1007210190 6:40187430-40187452 TGTGGGTACAGAATGGCTGGGGG + Intergenic
1007510367 6:42370107-42370129 AGGGGGTAAAGGATGGATGCAGG + Intronic
1008851910 6:56032696-56032718 AAGAAGGACAGAATGTATGGTGG + Intergenic
1010134656 6:72537090-72537112 AGGCAGTTCAGAGTGGTTGGAGG + Intergenic
1010285899 6:74077472-74077494 AGGCTGTACAGAAAGCATGGTGG - Intergenic
1010291872 6:74147079-74147101 AGGGAATACAGAATGGGTAGTGG - Intergenic
1011903539 6:92332119-92332141 AGGGAGAACATCATGGATAGGGG + Intergenic
1012002197 6:93666869-93666891 GGGGAATACTGAATGGATAGTGG + Intergenic
1012300726 6:97584733-97584755 AGGGAGGACAAGATGGAGGGAGG - Intergenic
1013221704 6:108083383-108083405 AGGAAGGAGAGAATGGATGTTGG - Intronic
1015473173 6:133629425-133629447 AAGGAATACAGAATGAATAGTGG + Intergenic
1015502257 6:133946653-133946675 AGGAAATACAGAATGGGTAGAGG - Intergenic
1015573593 6:134647460-134647482 AGGAAGAACAGAATGGATGGTGG + Intergenic
1015619714 6:135118411-135118433 AGGTAATACAGAATTGAGGGAGG - Intergenic
1016784310 6:147993290-147993312 AGGGAGTAAAGAAAGGGAGGAGG + Intergenic
1017388311 6:153911188-153911210 AGGGAATACTGAATGGGTGGTGG - Intergenic
1017669529 6:156756697-156756719 AGGGAGGACAGAAGGGAGGGAGG + Intergenic
1018601028 6:165540969-165540991 AGGGAGGAAAGAATGAAGGGAGG + Intronic
1018943732 6:168329654-168329676 AGAGAGCACAGCATGGAGGGAGG - Intergenic
1019253281 7:31968-31990 AAAGAGTAGAGAATGGAAGGTGG - Intergenic
1019908610 7:4083709-4083731 AGGAAGTAAAGAAGGGAGGGAGG - Intronic
1019908624 7:4083762-4083784 AGGGAGGAAAGAAGGGAGGGAGG - Intronic
1020194196 7:6024683-6024705 AGGGATGACGGAAAGGATGGGGG - Exonic
1020666297 7:11047880-11047902 AGGGAGGAAAGAAGGGAGGGAGG + Intronic
1020870908 7:13627928-13627950 AGGGAATACAAAATGGACAGAGG - Intergenic
1021607236 7:22420357-22420379 AGGGAGAACACCATGGATTGAGG - Intronic
1021697133 7:23286358-23286380 AGGGAGGAGAGAGTGGAAGGAGG - Intergenic
1022628432 7:32062111-32062133 AGTGGGAACAGAATGAATGGGGG - Intronic
1022903271 7:34831453-34831475 AGGGAGAAAAGAAAGGAGGGGGG + Intronic
1023167597 7:37358114-37358136 AGGGAGTACAGACAGGCTGTGGG - Intronic
1023259474 7:38344395-38344417 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023259932 7:38348720-38348742 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023260915 7:38357879-38357901 AGGGAGGAAAGGATGGATGGAGG + Intergenic
1023531971 7:41167100-41167122 TGGGAGGACAAAATGGAAGGGGG + Intergenic
1023673883 7:42609731-42609753 AGGAAGAACAGAGAGGATGGAGG + Intergenic
1024158940 7:46654793-46654815 AGGGAATACAGAATGGATAGTGG - Intergenic
1024375941 7:48638059-48638081 AATTAGTACTGAATGGATGGAGG + Intronic
1024482790 7:49882601-49882623 AGTGAGTACAGAAAGGAGGCAGG + Intronic
1024721773 7:52144835-52144857 AGGGAATACACAATGGGTGGTGG + Intergenic
1028122999 7:87078292-87078314 AGGGAGTAAGGAAAGGAAGGAGG + Intergenic
1028467534 7:91169796-91169818 AGGTAGAAAAGAATGGAGGGAGG + Intronic
1030192484 7:106823549-106823571 AGAGAATACAGAATGGATATTGG - Intergenic
1030192674 7:106824965-106824987 AGGGAATACAGAATGGATATTGG + Intergenic
1030215203 7:107037812-107037834 GGGGAGTCCAGAAGGGAAGGAGG + Intergenic
1030889785 7:114985408-114985430 AGGGAGTTGAGAATAGAGGGAGG + Intronic
1031370854 7:120964421-120964443 AGGGATTAGAGAATGGGAGGAGG - Intronic
1031983941 7:128150294-128150316 AGGGGGTATAGAAAGGTTGGGGG + Intergenic
1032011257 7:128349681-128349703 AGGGATTACAGAGTGCCTGGTGG + Intergenic
1032315694 7:130836519-130836541 AGTGAGGACAGCATGGATTGGGG - Intergenic
1033142294 7:138838334-138838356 GGGGAGAACAGAAGGGAGGGAGG + Intronic
1034291324 7:149934409-149934431 AGGGAATACAGAATGGATCCTGG + Intergenic
1036218849 8:6903648-6903670 AGGGGGAAGAGAAAGGATGGGGG + Intergenic
1036482197 8:9149648-9149670 AGGGAACACAGAATTGTTGGAGG - Intronic
1037383398 8:18312198-18312220 AGGGAATACAGAATGGATCATGG + Intergenic
1037896334 8:22658798-22658820 AGGGAGGTGAGAATGGAGGGAGG + Intronic
1037920899 8:22804786-22804808 AGGGAGACCAGGAAGGATGGAGG - Intronic
1038365341 8:26926331-26926353 AAAGAATACAGTATGGATGGGGG + Intergenic
1038454172 8:27661694-27661716 AGGGAATACAGAATGGGGAGTGG - Intronic
1039182069 8:34878088-34878110 AGGGAGAAAAGAAGGGAGGGAGG + Intergenic
1039587509 8:38719561-38719583 AGGGAGGAAAGAAGGGAGGGAGG - Intergenic
1041140752 8:54816808-54816830 GGGAAGCACAGAATGGATGAAGG - Intergenic
1041274190 8:56141286-56141308 AGGGAATACAGAATGGGTAGCGG - Intergenic
1042165087 8:65937658-65937680 AGGGAGGAAAGAAAGGAGGGAGG - Intergenic
1042520351 8:69704920-69704942 AGGGAGAACAGCTTGGAGGGAGG + Intronic
1043035766 8:75196978-75197000 AGGGAATAAAGAAAGGAAGGAGG - Intergenic
1043057841 8:75462409-75462431 AGGGTGTACAGAGTGGATTCAGG + Intronic
1043225788 8:77728406-77728428 AGGGGGAACAGACTGGAGGGAGG - Intergenic
1043710710 8:83414576-83414598 AAAGAGTACAGTATGGAGGGTGG - Intergenic
1045401952 8:101828148-101828170 ATGGAGGACAGACTGAATGGGGG - Intronic
1046437577 8:114212214-114212236 ATGTAGCACAGAATGAATGGGGG + Intergenic
1046949438 8:120005735-120005757 AGTGAGCACAGGATGGATGGGGG + Intronic
1047776269 8:128073362-128073384 AGGGAGGAATGAAGGGATGGAGG - Intergenic
1048238806 8:132720220-132720242 AGGGAGTAGAGTAAGGAAGGGGG - Intronic
1048950188 8:139490151-139490173 TGGGAGAACAGAATGAATGGGGG - Intergenic
1049102300 8:140588573-140588595 AGGGAGTAAAGAAGGGAGGCAGG + Intronic
1049233411 8:141495922-141495944 AAGGATAAAAGAATGGATGGGGG - Intergenic
1049409647 8:142466742-142466764 AGGGAGTAGAGATGGGGTGGTGG + Intronic
1049570817 8:143369545-143369567 AGGGACTTCAGAAGGGAAGGAGG - Intronic
1049848425 8:144817213-144817235 AGGGAGTACATAATCACTGGGGG - Intergenic
1050262207 9:3852313-3852335 AGGGAGTATAGAAGAAATGGGGG + Intronic
1050731717 9:8716710-8716732 AGGAAGAAGAGAATGGGTGGTGG + Intronic
1052174666 9:25443697-25443719 AGGGAGGAAAGAAGGGAGGGAGG - Intergenic
1052661316 9:31435750-31435772 AGGATGTACAGAAAGCATGGTGG - Intergenic
1052895251 9:33741666-33741688 TGGGAATACAGAATGGGTAGTGG - Intergenic
1053695698 9:40637583-40637605 AGGGAATACAGAATGAATAGTGG - Intergenic
1053942688 9:43268626-43268648 AGGGAATACAGAATGAATAGTGG - Intergenic
1054306945 9:63436801-63436823 AGGGAATACAGAATGAATAGTGG - Intergenic
1054405676 9:64760789-64760811 AGGGAATACAGAATGAATAGTGG - Intergenic
1054439303 9:65246276-65246298 AGGGAATACAGAATGAATAGTGG - Intergenic
1054491104 9:65775663-65775685 AGGGAATACAGAATGAATAGTGG + Intergenic
1055628039 9:78194621-78194643 GAGGAGAACAGAATGGTTGGCGG + Intergenic
1057079004 9:92158414-92158436 AGAGAGTACAGCATGGAGAGGGG - Intergenic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1059461215 9:114431527-114431549 AGGAAATAGTGAATGGATGGGGG + Intronic
1059617686 9:115968473-115968495 AGGCTGTACAGAAAGCATGGTGG + Intergenic
1059994089 9:119892555-119892577 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
1060017093 9:120096305-120096327 AGGGAATAGAGAATGGAGGAGGG - Intergenic
1060502079 9:124166048-124166070 ATGGTGAACAGTATGGATGGAGG + Intergenic
1062615067 9:137392625-137392647 AAGCAGCACAGAAAGGATGGGGG + Intronic
1062747088 9:138220401-138220423 AAAGAGTAGAGAATGGAAGGTGG + Intergenic
1202778143 9_KI270717v1_random:11195-11217 AGGGAATACAGAATGAATAGTGG - Intergenic
1203524366 Un_GL000213v1:71309-71331 CTGGAATACAGAATTGATGGAGG + Intergenic
1186049826 X:5579454-5579476 AGGGAGAATAAAATGGAGGGTGG + Intergenic
1186188185 X:7042085-7042107 AGGGAGAAGGGAATGCATGGTGG - Intergenic
1186404583 X:9290753-9290775 AGGGGGCACAGAATGAATTGGGG + Intergenic
1186497621 X:10024495-10024517 AGGGAGAACCGAATGGCTCGGGG - Intronic
1186731506 X:12415372-12415394 GGGGAGGAGAGGATGGATGGAGG - Intronic
1189032218 X:37462415-37462437 AGGGAAAACAGAATGGGTAGTGG - Intronic
1189777012 X:44479210-44479232 AGGGAGTACACATTGGAAGCAGG + Intergenic
1190222406 X:48520855-48520877 AGGGAGCACAGCATGGATAAAGG + Intergenic
1190765967 X:53475872-53475894 AGGGAGTATGGAATGGCTAGTGG + Intergenic
1191895332 X:65986785-65986807 AGGGAGAACAGAAAGGAAGAAGG - Intergenic
1192034583 X:67547988-67548010 AGGGAGGACAGACTGAATTGGGG + Intronic
1192209335 X:69117688-69117710 AGAGTGAACAGAATGGATGAAGG - Intergenic
1192632645 X:72789266-72789288 AGGGAGGAAGGGATGGATGGGGG + Intronic
1192649064 X:72931535-72931557 AGGGAGGAAGGGATGGATGGGGG - Intronic
1192896553 X:75448319-75448341 AGGGAGTACAGAATGGATGGTGG + Intronic
1194235606 X:91379868-91379890 AGGGAGTACAAAATGGGTAGTGG + Intergenic
1194345374 X:92756818-92756840 AGGCTGTACAGAAAGCATGGTGG - Intergenic
1194482850 X:94448029-94448051 AGGGAATGCAGAATGGGTAGTGG + Intergenic
1194649687 X:96499974-96499996 AGGGAATACAGAATGGGTAGTGG + Intergenic
1194651605 X:96521758-96521780 AGGGAGGAAAGAAGGGAGGGAGG + Intergenic
1195828714 X:109032333-109032355 AGGAAGTACAGAAGAGATGTGGG - Intergenic
1196892619 X:120305857-120305879 GGGGAAGACAGGATGGATGGTGG - Intronic
1197096354 X:122600482-122600504 AAAGAGTACAGTATGGAGGGAGG + Intergenic
1197386524 X:125810299-125810321 AGGGAATACAGAATGGGTAATGG - Intergenic
1197737719 X:129864152-129864174 AGGCACTAAAGAATGGATTGTGG - Intergenic
1198069968 X:133138561-133138583 AGGGAGAAAAGAAAGGAGGGAGG + Intergenic
1198343529 X:135737916-135737938 AGGGAGTATAAAATGGGTAGTGG - Intergenic
1200653717 Y:5873468-5873490 AGGCTGTACAGAAAGCATGGTGG - Intergenic
1201193464 Y:11469499-11469521 AGGGAATACAGAATGGATAGTGG - Intergenic
1201625726 Y:16012354-16012376 AGGGAGGAAAGAAAGGAGGGAGG + Intergenic
1201736255 Y:17265237-17265259 AGGAAGGAAAGAATGGAGGGAGG + Intergenic