ID: 1192899817

View in Genome Browser
Species Human (GRCh38)
Location X:75484695-75484717
Sequence TACCTAGCTGTGGGATTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 625}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192899817_1192899821 16 Left 1192899817 X:75484695-75484717 CCCAAGAATCCCACAGCTAGGTA 0: 1
1: 0
2: 6
3: 68
4: 625
Right 1192899821 X:75484734-75484756 AAAAACATATATCTCCACAAAGG 0: 1
1: 1
2: 3
3: 42
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192899817 Original CRISPR TACCTAGCTGTGGGATTCTT GGG (reversed) Intronic
901121897 1:6902207-6902229 TACCTAGAAGTGGGATTGCTGGG - Intronic
901207359 1:7504638-7504660 TACATGGCTGTGGGCATCTTTGG - Intronic
902252951 1:15167547-15167569 TACCTAGGAGTGGAATTATTGGG + Intronic
902559714 1:17269944-17269966 TACCTAGCAGTGGAATTGCTGGG + Intronic
903429268 1:23280003-23280025 TACCTAGGAGTGGAATTATTGGG - Intergenic
903920957 1:26800333-26800355 CACCTAGCTGTGGCATTGTTAGG - Intergenic
904865980 1:33579328-33579350 CTACTAGCTGTGGGATTATTAGG - Intronic
905485709 1:38294712-38294734 TACCCAGCAGTGGGATTGCTGGG + Intergenic
906812322 1:48840732-48840754 TACCTAGCAGTGAGATTGCTGGG - Intronic
906845444 1:49186442-49186464 TACCTAGCTTTGTGGTCCTTGGG + Intronic
906857285 1:49321556-49321578 TACCTAGAAGTGGGATTGTTGGG - Intronic
908091496 1:60690366-60690388 TACCTAGTAATGGGATTGTTGGG - Intergenic
909383667 1:75032004-75032026 TACCTAGGAGTGGAATTCCTGGG - Intergenic
909458162 1:75873932-75873954 TACCCAGCAATGGGATTGTTGGG + Intronic
909515972 1:76507788-76507810 TACCTAGAAGTGGAATTGTTAGG + Intronic
910102065 1:83588133-83588155 TACCTAGCAGTGGAATTACTGGG + Intergenic
910183524 1:84510640-84510662 TAGCTAGCAGTGGGATTCCTGGG - Intergenic
910314350 1:85865600-85865622 TTCCTTGCTGTGGTATTCTACGG + Intronic
910596578 1:88987007-88987029 TACCTAGCAGTGGAATGGTTGGG - Intronic
910715898 1:90229855-90229877 TACCTAGTAGTGGGATTGCTGGG + Intergenic
910793134 1:91071830-91071852 TACCCAGCGATGGGATTATTGGG - Intergenic
911004719 1:93208126-93208148 TACCTAGGAGTAGAATTCTTGGG + Intronic
911691534 1:100840136-100840158 TACCCAGCAATGGGATTCCTGGG + Intergenic
911869111 1:103070041-103070063 TACCTAGATGTGGAATGCATGGG - Intronic
912429833 1:109623282-109623304 TACCTACCTCTGGGAGGCTTTGG - Intronic
912557032 1:110523944-110523966 TACCTTTCTTTTGGATTCTTGGG + Intergenic
912760519 1:112362266-112362288 TACCTAGGAGTGGAATTGTTGGG - Intergenic
912902220 1:113663712-113663734 TACCTAGGAGTGGAATTGTTGGG + Intronic
913096208 1:115518209-115518231 TACCCAGCAGTGGGATTGCTGGG + Intergenic
913433348 1:118820159-118820181 TACCTAGTAATGGGATTGTTGGG - Intergenic
914880967 1:151546888-151546910 TACCTAGGAGTGGGATTGCTGGG + Intronic
914924076 1:151868760-151868782 TACCTAGCAGTGGAATTGCTGGG + Intergenic
915177921 1:154032215-154032237 TGTCTAGCAGTGGGATTGTTGGG + Intronic
916322475 1:163520414-163520436 TATCTAGCAGTGGGATTGCTGGG - Intergenic
916339718 1:163718325-163718347 TACCTAGCAATGGGATTGCTTGG - Intergenic
916514657 1:165504684-165504706 TACCTAGGAGTGGAATTGTTGGG - Intergenic
916840296 1:168593690-168593712 TACCTAGCAGTGGAATTGCTGGG + Intergenic
917557436 1:176104768-176104790 TACCTAGAAGTGGGATTGCTGGG - Intronic
917629854 1:176880808-176880830 CAACTAGCTGTGTGATTCTGGGG + Intronic
917665889 1:177225094-177225116 TACCCAGCTGAGGACTTCTTGGG - Intronic
917701129 1:177582386-177582408 TACCTAGTAGTGGGATTTCTAGG - Intergenic
918027784 1:180769788-180769810 TACCCAGCAGTGGGATTGCTGGG + Intronic
918282050 1:183016486-183016508 TACCTAGGAGTGGAATTGTTGGG - Intergenic
918329057 1:183438942-183438964 TACCTAGGAGTGGTATTGTTGGG - Intergenic
918759968 1:188391582-188391604 TACCTAGTAATGGGATTGTTGGG - Intergenic
919303518 1:195800604-195800626 TACCTAGGAGTGGAATTGTTGGG - Intergenic
921351218 1:214237633-214237655 TACCTAGTAGTGGGATTGCTGGG - Intergenic
921518551 1:216129263-216129285 TACCCAGCAGTGGGATTGCTGGG + Intronic
921767291 1:218987183-218987205 TACCTAGCAATGGGATTGCTGGG + Intergenic
922819577 1:228474812-228474834 TACCTAACCTTGGGATGCTTTGG + Intergenic
922877663 1:228952867-228952889 AACCCAGCTGTGGGATTGCTGGG + Intergenic
922913532 1:229237141-229237163 TACCTAGGGGTGGGATTATTGGG - Intergenic
923054838 1:230418168-230418190 TACCTAGGAGTGGGATTGCTAGG - Intronic
923382200 1:233432382-233432404 TACCCAGTAGTGGGATTCCTGGG + Intergenic
923732833 1:236569760-236569782 TACCTAGGAGTGGAATTGTTGGG - Intronic
924792016 1:247260251-247260273 TACCTAGTAGTGGGATTGCTGGG - Intergenic
1063092908 10:2883991-2884013 TACCTAGCAGTGGGACTGCTGGG - Intergenic
1063596410 10:7439870-7439892 TACTTAGGTGTGGCATTCTGTGG + Intergenic
1064989810 10:21246339-21246361 TACCCAGCAGTGGGATTACTGGG - Intergenic
1065096823 10:22289041-22289063 TACCTAGGAGTGGAATTCCTGGG + Intergenic
1065760221 10:28974952-28974974 TACCTGGCAATGGGATTGTTGGG + Intergenic
1066423944 10:35287972-35287994 TACCTAGGAGAGGGATTCCTAGG + Intronic
1066597824 10:37071418-37071440 TACCCAGCAGTGGGATTACTGGG + Intergenic
1067303848 10:45040059-45040081 TACCTAGTAGTGGGATTGCTGGG - Intergenic
1067317521 10:45181895-45181917 TACCTAGCAATGGGATTGCTGGG - Intergenic
1067367972 10:45653797-45653819 TACCCAGTAGTGGGATTGTTGGG - Intronic
1067555854 10:47269848-47269870 TACCTAGGTGTGGGAATGCTGGG + Intergenic
1067969381 10:50952572-50952594 TATCTAGGAGTGGGATTATTGGG + Intergenic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1068198399 10:53748500-53748522 TACCTGGCAGTGGGATTGATGGG + Intergenic
1068280970 10:54869242-54869264 TAGCTATCTTTGGCATTCTTTGG - Intronic
1068372200 10:56131577-56131599 TACCCAGCAATGGGATTGTTGGG - Intergenic
1068396819 10:56472823-56472845 TACCTAGCTTTGGGAGTTGTGGG + Intergenic
1068925928 10:62538294-62538316 TACCTAGGAGTGGGATTGCTGGG - Intronic
1069025551 10:63536986-63537008 TAGCTAGTTGTGGGATTGCTGGG - Intronic
1069335969 10:67350825-67350847 TACCTAGAAGTAGGATTTTTGGG - Intronic
1069711509 10:70492110-70492132 TACTTAGCAGTGGGATTGCTTGG + Intronic
1070516395 10:77212076-77212098 TACCCAGTAGTGGGATTGTTGGG - Intronic
1070598494 10:77849399-77849421 TGCCTGGCTGTGGGATGCTCAGG - Intronic
1071529130 10:86376081-86376103 TACCTAGCAGTGGAATTGCTGGG + Intergenic
1072083321 10:92054807-92054829 TATCCAACTGTGGGATTCTTGGG - Intronic
1072375246 10:94808945-94808967 TACCTAGCAGTGGGATTGCTGGG + Intronic
1072678355 10:97485954-97485976 TACCTAGTAGTGGGATTGTTGGG - Intronic
1073229264 10:101953856-101953878 TACCTAGCAATGGGATTTTGGGG - Intronic
1073264084 10:102213891-102213913 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1073951434 10:108813883-108813905 TACCTAGCTTTTGCATTCTCAGG - Intergenic
1074574595 10:114656432-114656454 TACCTAGGTGTGGAATTTCTGGG - Intronic
1075462075 10:122623417-122623439 TACCTAGGAGTGGGATTGCTCGG + Intronic
1075531308 10:123232344-123232366 TACCTGGCTGTGTGGTTCTAGGG + Intergenic
1075552960 10:123406957-123406979 TACCTAGGAGTGGAATTCCTGGG - Intergenic
1075930950 10:126295221-126295243 TTACTAGCTGTGTGATGCTTTGG + Intronic
1076164665 10:128272083-128272105 TACCTAGCAGTGGAATTGCTAGG - Intergenic
1076346374 10:129781463-129781485 TTCCTAGCTGTGGGACCCTCAGG + Intergenic
1077396153 11:2323463-2323485 TACCTAGCAATGGGATTGCTGGG - Intergenic
1078072533 11:8126075-8126097 TACCTAGGAGTGAGATTTTTGGG - Intronic
1078189660 11:9082452-9082474 TACCTAGGAGTGGGATTGCTGGG - Intronic
1078312745 11:10261606-10261628 TACCTAGCAGTTGAATTTTTGGG - Intronic
1078554300 11:12306970-12306992 TTCCTAGCTATGGGGTTGTTTGG + Intronic
1078811339 11:14768875-14768897 TACCTAGCTGTGGAATTCCTGGG + Intronic
1079279946 11:19078072-19078094 TTCCTAGCTCTGGGATTCCCTGG - Intergenic
1079483378 11:20908182-20908204 TACCCAGCAATGGGATTCCTGGG - Intronic
1079700136 11:23535706-23535728 TACCTAGTAGTGGGATTGCTGGG + Intergenic
1079868384 11:25763922-25763944 TACCTAGTAATGGGATTATTGGG - Intergenic
1079982761 11:27168724-27168746 TACCTAGAAGTGGGATTGTTGGG + Intergenic
1080244293 11:30162405-30162427 TACCTTGGTGTGGTTTTCTTGGG - Intergenic
1080638490 11:34143935-34143957 TCACTAGCTGTGTGCTTCTTGGG - Intronic
1080856838 11:36119325-36119347 TACCTAGAAGTGGAATTGTTGGG + Intronic
1081005696 11:37734971-37734993 TATCTAGATGTGGAATTGTTAGG + Intergenic
1081539392 11:44019290-44019312 TACCTAGCAGTGGAATTGTTGGG + Intergenic
1081569758 11:44282445-44282467 TACCTAGGAGTGGGATTGCTGGG - Intronic
1082772121 11:57215936-57215958 TACCCAGCAGTGGGATTGCTTGG + Intergenic
1083072999 11:60006158-60006180 TACCCAGGTATGGGATTGTTGGG + Intergenic
1083114796 11:60450398-60450420 TAACTAGCAGTGGAATTGTTGGG - Intronic
1083492005 11:63020386-63020408 AACCTACCTATGGGATTGTTGGG + Intergenic
1084567777 11:69941524-69941546 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1085369633 11:75988615-75988637 TAACTAGGTGTGGGATTGCTGGG + Intronic
1085902172 11:80714281-80714303 TACCCAGCAATGGGATTGTTGGG + Intergenic
1086068578 11:82773002-82773024 TACCTAGTAATGGGATTGTTGGG + Intergenic
1086201070 11:84203093-84203115 TACCTAGTAATGGGATTGTTCGG - Intronic
1086473614 11:87145441-87145463 TACCCAGCAGTGGGATTGCTGGG + Intronic
1086780996 11:90905633-90905655 TTCCTAGCAGTGGAATTATTGGG - Intergenic
1087263062 11:96032253-96032275 TACCTAGGAGTGGGATTCTTCGG - Intronic
1088071253 11:105788371-105788393 TACCTAGTAGTGGGATTGCTGGG - Intronic
1088382711 11:109213956-109213978 TACCTTCCTGTGGGGTACTTGGG + Intergenic
1088614301 11:111608808-111608830 TGCCTAGCAATGGAATTCTTGGG + Intronic
1088967689 11:114740477-114740499 TACCCAGAAGTGGGATTGTTGGG + Intergenic
1089853202 11:121518073-121518095 TAGCTAGATGTTGGATGCTTTGG + Intronic
1090694306 11:129221995-129222017 TGCCTATCTGCAGGATTCTTTGG - Intronic
1090777763 11:129980174-129980196 TACCTAGCAGTGGAATTGCTTGG - Intronic
1091050935 11:132370492-132370514 TACCTAGAAATGGGATTGTTGGG - Intergenic
1091180819 11:133602826-133602848 TACCTAGGAGTGGGATTGCTGGG + Intergenic
1091569911 12:1675708-1675730 TGCCTAGCAGTGGAATTCTGGGG + Intergenic
1091811282 12:3400001-3400023 CTCCTAGATGTTGGATTCTTAGG - Intronic
1092116260 12:6010488-6010510 TTCCTAGAAGTGAGATTCTTGGG - Intronic
1092514111 12:9190122-9190144 TACCCAGTACTGGGATTCTTGGG - Intronic
1093260699 12:16933963-16933985 TACCTAGTAGTGGGATTGCTGGG + Intergenic
1093361148 12:18229967-18229989 TACCTGGTAGTGGAATTCTTGGG + Intronic
1094211680 12:27900003-27900025 TACCTAGTAGTGGGATTGCTGGG - Intergenic
1094262219 12:28513973-28513995 TACCTAGCAATGGGATTTCTGGG + Intronic
1094482394 12:30895190-30895212 TTTCTAGATGTGGGATTCTTAGG + Intergenic
1094607793 12:31964040-31964062 TACCTAGGAGTGGAATTCCTTGG + Intronic
1095119859 12:38404414-38404436 TACCTAGCAATGGGATTGCTGGG + Intergenic
1095149472 12:38774985-38775007 TACATACCTTTGGGATTCTGGGG - Intronic
1096753388 12:53778183-53778205 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1097503369 12:60434387-60434409 TACCCAGTAGTGGGATTGTTGGG - Intergenic
1098529073 12:71520029-71520051 TATCTAGTAGTGGAATTCTTGGG - Intronic
1098830485 12:75355608-75355630 TACCTAGCGATGGGATTGCTGGG - Intronic
1099701420 12:86087183-86087205 TACCCAGCAATGGGATTCCTGGG + Intronic
1100684642 12:96973985-96974007 TATATATCTATGGGATTCTTTGG - Intergenic
1100994262 12:100285437-100285459 TACCTAGGTGTGGGATTGCTAGG + Intronic
1101332315 12:103767058-103767080 TACCTAGGGGTGGCATTTTTGGG - Intergenic
1101839782 12:108319962-108319984 TACCTGGCTTTGGGTTTCTTGGG - Intronic
1101905863 12:108825887-108825909 TACTCAGCTGTGAGATTCTAAGG - Intronic
1102990184 12:117309873-117309895 TTCCTAGAAGTGGGATTGTTGGG - Intronic
1103426471 12:120839792-120839814 TACCTAGGAGTGGGATTGCTGGG - Intronic
1103671197 12:122617222-122617244 TACCTAGAAGTGGGCTTGTTGGG + Intronic
1103892571 12:124250859-124250881 TACCCAGCAGTGGGATTGCTGGG - Intronic
1105735508 13:23265893-23265915 TACCCAGCAGTGGGATTGCTAGG - Intronic
1106366492 13:29085800-29085822 TACCCAGCAGTGGGATTGCTAGG + Intronic
1107282292 13:38750638-38750660 TACCTAGCAGTGGGATAACTGGG + Intronic
1108952412 13:56111883-56111905 TACCTAGCAGTAGGATTGCTGGG + Intergenic
1110597168 13:77331895-77331917 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1110671060 13:78178535-78178557 TACCCAGTAGTGGGATTGTTGGG + Intergenic
1111604307 13:90518357-90518379 TAAATCGCTGTGGAATTCTTTGG + Intergenic
1111704550 13:91732044-91732066 TACCCAGTAGTGGGATTGTTGGG + Intronic
1112447210 13:99475201-99475223 TACCTAGGAGTGGGATTAATGGG + Intergenic
1112465945 13:99645030-99645052 TACCTAGCATTGGGATTGCTGGG + Intronic
1112833190 13:103478820-103478842 TACCCAGTAGTGGGATTGTTGGG + Intergenic
1112983225 13:105412942-105412964 TACCTAGCTGCGGAATTGCTGGG + Intergenic
1113412088 13:110099439-110099461 TACCTAGAAGTGGGATTGCTGGG - Intergenic
1113452088 13:110417913-110417935 TACCTAGGAGTGGGATTGTTGGG + Intronic
1114370191 14:22077987-22078009 TACCTGGCCATGGGATGCTTAGG + Intergenic
1114931677 14:27476832-27476854 TACCTAGAAGTGGGATTGCTGGG + Intergenic
1115053585 14:29094832-29094854 TACCTAGCAGTGGGATTGCTAGG + Intergenic
1115696769 14:35907822-35907844 TATCTTGCTGTGGATTTCTTTGG - Intronic
1115755608 14:36524248-36524270 TGCCTAGCTGTGGGAGACTGCGG - Intergenic
1116355202 14:43919610-43919632 TACCCAGCAATGGGATTCTTGGG + Intergenic
1116489511 14:45489691-45489713 TACCTAGTAGTGGGATTGCTGGG - Intergenic
1116725356 14:48555892-48555914 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1117155905 14:52940964-52940986 TACCTAGGTGTGGGATTGCTGGG - Intronic
1117397412 14:55324437-55324459 TACCTAGCAGTGGAATTGCTGGG + Intronic
1117753621 14:58950006-58950028 TACCTAGGAGTGAGATTGTTAGG + Intergenic
1118097472 14:62553918-62553940 TATCTAGGAGTGGGATTCCTGGG - Intergenic
1118435646 14:65768562-65768584 TACCCAGTAGTGGGATTGTTGGG + Intergenic
1118996020 14:70836964-70836986 TACCTAGGAGTGGGATTGCTGGG - Intergenic
1119048482 14:71342338-71342360 TACCTAGTAGTGGGATTGCTGGG + Intronic
1119116020 14:72022289-72022311 TACCCAGCAGTGGGATTGCTGGG + Intronic
1119297036 14:73541374-73541396 TACCTAGGAGTGGGATTGCTGGG + Intronic
1119301276 14:73573275-73573297 TACCTAGGAGTGGGATTGCTGGG + Intronic
1119345470 14:73920071-73920093 TTCCTAGAAGTGGGATTCCTAGG + Intronic
1119634439 14:76262572-76262594 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1120663384 14:87277345-87277367 CACCGAGCAGTGGGATTGTTGGG + Intergenic
1120806893 14:88761707-88761729 TACCCAGTAATGGGATTCTTGGG + Intronic
1121612574 14:95291680-95291702 TACCTAGATGTGGAAATATTGGG - Intronic
1122821959 14:104351795-104351817 TACCCAGCTGTGAGATTACTGGG + Intergenic
1122965553 14:105123243-105123265 TACCTAGGAGTGGGATTGCTGGG - Intergenic
1124024486 15:25952562-25952584 AACCTAGCAGTGGGATTACTGGG + Intergenic
1124855513 15:33383742-33383764 TACCTAGCAATGGGATTGCTGGG - Intronic
1125072265 15:35569255-35569277 TACCCAGAAGTGGGATTATTGGG + Intergenic
1125138789 15:36377956-36377978 AACCTAGCAGTGGGATTGCTGGG + Intergenic
1125276498 15:37997722-37997744 TGCCTAGCAGTGGGATTACTGGG + Intergenic
1125380140 15:39078680-39078702 TACCTAGGAGTGGAATTGTTAGG - Intergenic
1126046602 15:44647393-44647415 TACCTAGCTGTGGAATTACTGGG - Intronic
1126184161 15:45814496-45814518 TACCTAGGAGTGGGATTGCTGGG + Intergenic
1126979216 15:54222604-54222626 TACCTAGCAGTGAGATTGCTGGG + Intronic
1127024687 15:54791202-54791224 TACCTAGCAGTGGAATTTCTGGG - Intergenic
1127196106 15:56587582-56587604 TACCTAGCTATAGGAATCGTTGG + Intergenic
1127541952 15:59948938-59948960 TACGTAGGAGTGGGATTCCTGGG - Intergenic
1127565234 15:60181550-60181572 TACCTAGAAGTGGGATTACTGGG - Intergenic
1128489344 15:68131866-68131888 TACCTAGAAGTGGGATTGCTGGG + Intronic
1128492241 15:68159841-68159863 TACCTAGGAGTGGGATTGCTGGG + Intronic
1129075411 15:72991406-72991428 TACCTAGTTGTGGAATTGCTGGG - Intergenic
1129157282 15:73726431-73726453 TTCCTTGCTGTGGGATTTTTGGG - Intergenic
1129303041 15:74637524-74637546 TTCCTAGCTGTTAGATCCTTGGG - Intronic
1129624667 15:77184447-77184469 TACCTAGGAGTGGGATTGCTGGG - Intronic
1129802454 15:78425716-78425738 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1131360746 15:91788524-91788546 TACCTAGCTGAGGGATTAATAGG + Intergenic
1131982893 15:98012646-98012668 TACCTAGTTGTGGGATTGCTGGG - Intergenic
1131989033 15:98075053-98075075 TACCTAGTAGTGGGATTTCTGGG - Intergenic
1132465226 16:74343-74365 TGCCCAGCTGTGGCATGCTTTGG - Intronic
1132548023 16:542293-542315 TACCTAGGAGTGGGATTGCTGGG + Intronic
1132682335 16:1148044-1148066 TGCTTATCTGTGGGATACTTGGG + Intergenic
1133398842 16:5470011-5470033 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1133458447 16:5964375-5964397 TACCCAGAAGTGGGATTGTTGGG - Intergenic
1133489867 16:6257198-6257220 TACCTAGGTGAGGGGTTCATAGG - Intronic
1133604416 16:7372082-7372104 TTCCTAGCAGTGTGATTGTTGGG + Intronic
1133954105 16:10424965-10424987 TACCTAGCAGTAGAATTATTTGG - Intronic
1135803937 16:25524973-25524995 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1136094204 16:27942888-27942910 TACCCAGATGTGGAATTCCTGGG - Intronic
1136932376 16:34431013-34431035 TACCCAGTAGTGGGATTGTTGGG + Intergenic
1136972196 16:34980801-34980823 TACCCAGTAGTGGGATTGTTGGG - Intergenic
1137297203 16:47106548-47106570 TTCCTAGAAGTGGGATTGTTTGG - Intronic
1137325335 16:47429448-47429470 TACCTAGGAGTGGAATTGTTGGG + Intronic
1138290190 16:55840208-55840230 TACCTAGCTCTGGGGTGATTAGG - Intergenic
1139685547 16:68600545-68600567 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1139742814 16:69050090-69050112 TACCTAGAAGTGGAATTGTTGGG + Intronic
1139807410 16:69579814-69579836 TAACTGGCTGTGTGATTTTTAGG + Intronic
1140246942 16:73259197-73259219 CAGCTAGATGTGGGATTCCTGGG + Intergenic
1140961880 16:79921855-79921877 TACCTTGGTGTGGTTTTCTTTGG - Intergenic
1140962040 16:79925042-79925064 TACCTAGGAATGGGATTCCTGGG - Intergenic
1141244906 16:82296844-82296866 TACCTGGTTGTGGGATTGCTGGG + Intergenic
1143325575 17:6096143-6096165 CACCTAGCTGTAGGGTTGTTAGG - Intronic
1143752692 17:9041686-9041708 TACCTAGCAGTGGAATTGTTGGG + Intronic
1144725823 17:17502032-17502054 TACCTAGGTGTGGAATTGTTAGG - Intergenic
1146381671 17:32334266-32334288 TACCTAGGTGTGGAATTGCTAGG + Intronic
1146478136 17:33179639-33179661 TACCTACCTGTGGGGTTGTAAGG - Intronic
1146531830 17:33613975-33613997 TTGCTAGCAGTGGGATTCTTGGG + Intronic
1146830763 17:36067300-36067322 TTCCTAGCTGTGGGCTTCCTGGG - Intronic
1146995131 17:37313833-37313855 TACCTAGCTATGGGATTGCTGGG - Intronic
1147023303 17:37557326-37557348 TTCAGAGCTGTGGGTTTCTTAGG - Intronic
1147349897 17:39834199-39834221 TACCTAGGTGTGGAATTACTGGG + Intronic
1148221118 17:45862886-45862908 TACCAAGTTGTGGAATTCCTGGG - Intergenic
1148992411 17:51677859-51677881 TACCTAGGAGTGGCATTGTTGGG - Intronic
1149249117 17:54747714-54747736 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1150146033 17:62770380-62770402 TACCCAGCAATGGGATTGTTGGG + Intronic
1150581630 17:66479484-66479506 TACCTAGCCATGGGATTGCTGGG - Intronic
1150696125 17:67407024-67407046 TACCTAGGGGTGGGATTGCTGGG + Intronic
1151143977 17:72021775-72021797 TACCCAGCAATGGGATTGTTGGG - Intergenic
1152010756 17:77712532-77712554 TACCTAGGGGTGGGATTGCTGGG + Intergenic
1152564545 17:81094332-81094354 TACCAAGCTGTGGGTCTGTTGGG + Intronic
1153171591 18:2322710-2322732 TACCTAGAAGTGGGATTTCTGGG - Intergenic
1153573724 18:6499455-6499477 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1155013834 18:21812024-21812046 TACTTGGCTGTGGGCTTCTTGGG - Intronic
1155136242 18:22995901-22995923 TACCTAGGAGTGGAATTGTTGGG + Intronic
1155282828 18:24258097-24258119 TACCTAGCAGTGGGATTGCTGGG - Intronic
1155335386 18:24758773-24758795 TACCTAGGTATGGGATTGCTGGG + Intergenic
1155446326 18:25916575-25916597 AAACTATCTGTGGGATTATTGGG - Intergenic
1155523525 18:26693158-26693180 TACCTAGAAGTGGGATTGGTGGG + Intergenic
1155534370 18:26801638-26801660 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1155767898 18:29658763-29658785 TACCTAGCAGTGGGATTCCTGGG - Intergenic
1155837489 18:30604172-30604194 TACCCAGTTATGGGATTGTTGGG + Intergenic
1156056081 18:33005094-33005116 TATCTAGCAGTAGGATTGTTGGG - Intronic
1156768786 18:40693832-40693854 TACCTAAAAGTGGGATTGTTGGG - Intergenic
1157016775 18:43724640-43724662 TACCTAGTAATGGGATTGTTAGG - Intergenic
1157822329 18:50782138-50782160 TACCTAGGTGTGTGATTGCTGGG + Intergenic
1158078388 18:53559690-53559712 TACCCAGCAATGGGATTCCTGGG - Intergenic
1158145958 18:54312475-54312497 TACCCAGGAGTGGGATTCCTGGG + Intronic
1159611026 18:70525710-70525732 TACCCAGTTTTGGGATTCTCGGG + Intergenic
1159634220 18:70785613-70785635 CACCTAGAGGTGGGAATCTTGGG - Intergenic
1160214338 18:76914425-76914447 TACCTAGGAGTGGAATTGTTTGG + Intronic
1160615196 18:80120994-80121016 TACCTAGGAGTGGAATTTTTGGG + Intronic
1161624375 19:5317530-5317552 TTCCTAGCTGTGTGATTTTGCGG - Intronic
1162119530 19:8454583-8454605 TACCTAGCAGTGGAATTGCTGGG + Intronic
1163789227 19:19296698-19296720 TACCTAGGTGTGGAATTGCTGGG - Intronic
1164665043 19:30024298-30024320 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1165456671 19:35915652-35915674 TACCTAGGAGTGGGAGTGTTGGG - Intergenic
1168388028 19:55982272-55982294 TACCTAGCAGTGGGATTGCTAGG - Intronic
925782649 2:7396607-7396629 TACCTAGCAATGGGATTGTTGGG + Intergenic
926791879 2:16581689-16581711 TACCTAGGAGTGGAATTCCTCGG - Intronic
926996962 2:18746045-18746067 TACCTAGGAGTGGGATTGCTAGG + Intergenic
928532853 2:32209709-32209731 TACCTAATTGAGGGATTTTTTGG + Intronic
928555862 2:32424470-32424492 TACCTAGGAGTGGAATTGTTGGG + Intronic
929485422 2:42349091-42349113 TACCTAGGAGTGGAATTCCTGGG - Intronic
930117048 2:47726997-47727019 TACCTAGGAGTGGGATTTCTGGG + Intronic
930320472 2:49848346-49848368 TACCTAGGTGAGGGGTTCATAGG - Intergenic
930448511 2:51504892-51504914 TACCTAGTAGTGGGATTGCTGGG + Intergenic
930851845 2:55969686-55969708 TACCTAGAAGTGGGATTGCTGGG - Intergenic
930923050 2:56781295-56781317 TACCTAGGAGTGGGATTGTTGGG - Intergenic
932044792 2:68337426-68337448 TACATAGAAGTGGAATTCTTGGG + Intergenic
933295090 2:80480907-80480929 TTCCTTGGTGTGGGATTCCTAGG - Intronic
933503774 2:83150950-83150972 TTTCTGGCTGTGGCATTCTTAGG - Intergenic
933652732 2:84862249-84862271 TACCTGGCAGGGGGACTCTTTGG + Intronic
935241439 2:101181763-101181785 TACCTAGGGGTGGAATTGTTAGG + Intronic
935561539 2:104565153-104565175 TACCCAGCAGTGGGATTACTGGG - Intergenic
935952969 2:108347820-108347842 TACCCAGCAGTGGGATTGCTGGG + Intergenic
936257302 2:110927801-110927823 CACCTGGCTGTGGGATTGCTTGG + Intronic
936398132 2:112144962-112144984 TACCTGGGAGTGGGATTGTTGGG + Intronic
936892639 2:117390446-117390468 CAGCTATATGTGGGATTCTTGGG - Intergenic
937137864 2:119570892-119570914 TACCTAGAAGTGGAATTGTTAGG + Intronic
937639679 2:124197590-124197612 TACCTAGCAATGGGATTTCTTGG + Intronic
938878147 2:135555545-135555567 TACCTAGGAGTGGAATTCCTGGG - Intronic
938880191 2:135578034-135578056 TTCCTAGAAGTGGGATTGTTGGG - Intronic
938907161 2:135848508-135848530 TACCTAGGAGTGGAATTGTTGGG - Intronic
939441467 2:142255804-142255826 TACCTAGTTGTAGGATTGCTGGG + Intergenic
939565941 2:143786612-143786634 CATCTATCTGTGTGATTCTTGGG - Intergenic
940559369 2:155275055-155275077 TACCTAGCAGTGGGATTGTTGGG + Intergenic
940620925 2:156112611-156112633 TACCTAGGAGTGGAATTATTGGG + Intergenic
941056306 2:160793002-160793024 TGCCTTGCTGTGGCATTCTCTGG + Intergenic
941369663 2:164648555-164648577 TACCTAGAAGTGGGATTGCTGGG + Intergenic
941426059 2:165347072-165347094 TACCCAGTTATGGGATTCCTGGG - Intronic
942009139 2:171741294-171741316 TACCTAGGAGTGGGATTGTTGGG + Intronic
942333449 2:174853576-174853598 TACCTAGTAGTGGGATTGCTGGG - Intronic
942773128 2:179546739-179546761 CACCTAGCAGTGGGATTGTTGGG + Intronic
942845459 2:180419201-180419223 TACCTAGTAGTGGGATTGCTGGG - Intergenic
943296584 2:186147942-186147964 TACCTAGTAATGGGATTCCTGGG - Intergenic
943637565 2:190322958-190322980 TACCTAGGTATGGAATTGTTGGG - Intronic
943993716 2:194732798-194732820 TACCTAGTAGTGGGATTGCTGGG - Intergenic
944183130 2:196917846-196917868 TACCTAGGAGTGGAATTTTTGGG + Intronic
944252994 2:197596667-197596689 TACTTAGGAGTGGGATTATTAGG + Intronic
944695375 2:202196040-202196062 TACCTAGTAGTGGGATTGCTGGG + Intronic
944766332 2:202868450-202868472 TACCTAGCGGTGGAATTGCTAGG - Intronic
944783220 2:203041222-203041244 TCCATTGCTGTGGGAGTCTTAGG - Intronic
945278326 2:208011218-208011240 TACCTAGTAGTGGGATTGCTGGG - Intronic
945351981 2:208791538-208791560 TACCTAGCCGTGAGATTGATAGG + Intronic
945540217 2:211076239-211076261 TACCCAGTAATGGGATTCTTGGG - Intergenic
945880642 2:215321493-215321515 TACCTAGGAGTGGAATTCCTTGG + Intronic
946171148 2:217896508-217896530 TAGCTTGCGGTGGGATTCCTTGG - Intronic
946699383 2:222396427-222396449 TATCTAGGTGTGGTTTTCTTTGG - Intergenic
947134091 2:226959763-226959785 TACCTAGGAGTGGAATTGTTGGG + Intronic
947246962 2:228059255-228059277 TACCTAGGAGTGGGATTGCTGGG + Intronic
948775156 2:240283652-240283674 TACCTAGCGGTGGGATTGCTGGG - Intergenic
1168761462 20:352968-352990 CACCTAGCAGTGGGTTTCTCCGG - Intronic
1169666783 20:8046583-8046605 TACCTAGGTCTGGGATTGCTGGG - Intergenic
1169808450 20:9583552-9583574 TGTATAGCTGTTGGATTCTTTGG + Intronic
1170168754 20:13387674-13387696 TACCTAGTAATGGGATTATTGGG + Intergenic
1170189775 20:13634024-13634046 TACCTAGAAATGGAATTCTTGGG - Intronic
1170335040 20:15260624-15260646 TACCCAGTAGTGGGATTGTTGGG + Intronic
1170708827 20:18770436-18770458 TACCCAGCAGTGGGATTGCTAGG + Intergenic
1171008801 20:21495097-21495119 AACCTAGCGGTGTGTTTCTTTGG + Intergenic
1171936876 20:31283178-31283200 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1173568836 20:44063584-44063606 TACCAAGCAGTGGGATTGCTGGG - Intronic
1173642275 20:44612128-44612150 TACCTAGTAGTGGGATTGTTGGG + Intronic
1173764111 20:45590862-45590884 TACCTAGAAGTGGAATTTTTGGG + Intergenic
1173767332 20:45624573-45624595 TACCTAGTAGTGGGATTGCTGGG + Intronic
1174505840 20:51016964-51016986 TACCCAGAAGTGGGATTCCTGGG - Intronic
1174838844 20:53882763-53882785 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1174963745 20:55187095-55187117 TACCCTACTGTGGGATTCTGGGG + Intergenic
1176518313 21:7803869-7803891 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1176995203 21:15547305-15547327 TACCTAGTAGTGGGATTGCTGGG - Intergenic
1177652082 21:23969892-23969914 TACCAAGCAGTGGGATTTCTAGG + Intergenic
1177933111 21:27310201-27310223 TACCCAGTAGTGGGATTTTTGGG + Intergenic
1177945754 21:27468172-27468194 GAACTAGTTGGGGGATTCTTGGG + Intergenic
1178596116 21:33954342-33954364 TACCTAGGTTTGTGATTTTTTGG + Intergenic
1178652341 21:34433882-34433904 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1178764592 21:35438255-35438277 TTCCTAGAAGTGGGATTGTTTGG + Intronic
1179104276 21:38384151-38384173 CACCCAGCTGTGGGATACCTGGG - Intronic
1180567678 22:16688978-16689000 TTCCTAGAAGTGAGATTCTTGGG - Intergenic
1181838533 22:25632074-25632096 TACTTAGGAGTGGGATTATTGGG + Intronic
1181910906 22:26237510-26237532 TACCTACCTGTTGGGTTGTTAGG + Intronic
1181984329 22:26789149-26789171 TACCTAGAAGTGGGATTGCTGGG + Intergenic
1182267796 22:29132383-29132405 TACCTAGGAGTGGGATTGCTGGG + Intronic
1182514470 22:30846062-30846084 TACCTAGGAGTGGGATTGCTGGG + Intronic
1183870442 22:40737732-40737754 TACCCAGTAGTGGGATTCCTGGG - Intergenic
1183919736 22:41155955-41155977 TACCTAGGAGTGGAATTCCTGGG + Intronic
949893453 3:8750893-8750915 TACCTAGGAGTGGCATTCCTGGG + Exonic
950245447 3:11412382-11412404 CAACTATCTGTGGGACTCTTGGG + Intronic
950367907 3:12501486-12501508 TAGACAGCTTTGGGATTCTTAGG + Intronic
950680041 3:14578947-14578969 TACCTAGGAGTGGGATTGCTGGG - Intergenic
950693541 3:14680131-14680153 TACCTAGAAGTGGGATTGCTGGG - Intronic
951100952 3:18687828-18687850 TACTTAGAAGTGGGATTCCTGGG - Intergenic
951487064 3:23224855-23224877 TACCTAGCAGTGGAATTGCTGGG + Intronic
952327140 3:32331446-32331468 TACCCAGAAGTGGGATTGTTGGG - Intronic
952627727 3:35427155-35427177 TACCTGGTAGTGGGATTCCTGGG - Intergenic
952907054 3:38147074-38147096 TACCTTGGTGTGGATTTCTTGGG - Intergenic
953030573 3:39177386-39177408 TTCCTAGATGTGCGATTGTTAGG + Intergenic
953094688 3:39763818-39763840 TACCTAGGAGTGGGATTACTGGG - Intergenic
953245282 3:41185420-41185442 TCACTAGCTGTGGGATTGTAAGG - Intergenic
953461385 3:43084177-43084199 TGCCTTGGTGTGGGTTTCTTTGG + Intronic
953492059 3:43360983-43361005 TACCTAGAGCTGGAATTCTTTGG - Intronic
953539219 3:43800698-43800720 TACCTAGGAGTGAGATTGTTAGG - Intergenic
953602008 3:44375814-44375836 TACCTAGGAGTGGAATTCTTGGG - Intronic
955121637 3:56065622-56065644 TACCTAGGTGTTGGATTGATAGG - Intronic
956330291 3:68099626-68099648 TACCTAGTAATGGGATTGTTGGG - Intronic
956372352 3:68577065-68577087 TACCTAGTAGTGGGATTTCTGGG - Intergenic
956535786 3:70274659-70274681 TACCTAGGTGATGGATTGTTAGG + Intergenic
957018681 3:75099213-75099235 TACCTAGCAGTGAGATTTCTGGG + Intergenic
958003221 3:87777963-87777985 TACCCAGTAGTGGGATTGTTGGG - Intergenic
958013212 3:87907047-87907069 TACCTAGGAGTGGGATTGCTGGG + Intergenic
958088682 3:88847625-88847647 TACCCAGGATTGGGATTCTTGGG + Intergenic
958265274 3:91430858-91430880 TACCTAGTAATGGGATTCCTGGG + Intergenic
958760595 3:98303014-98303036 TACCTAGCAGTGGGATTGCTGGG - Intergenic
959036771 3:101375596-101375618 TACCTAGGAGTGGGATTGCTTGG - Intronic
960668732 3:120136242-120136264 TACCTAGCAGTGGGATTGCTGGG - Intergenic
961583925 3:127906660-127906682 TACCTAGCAATGGGATTGCTGGG - Intergenic
961631079 3:128299080-128299102 TACCCAGCAGTGGGATTGCTGGG + Intronic
962037885 3:131672341-131672363 TACCTAGCAGTGTGATTGCTGGG + Intronic
962077498 3:132098992-132099014 TACCTGGAAGTGGGATTATTGGG - Intronic
962329688 3:134466702-134466724 TACCTAGAGGTGGGATTGCTGGG + Intergenic
962513004 3:136121061-136121083 TACCCAGCAGTGGGATTGCTGGG - Intronic
962853237 3:139323457-139323479 TACCTAGGAGTGGGATTTCTGGG - Intronic
963167368 3:142219177-142219199 TACCTAGGAGTGGGATTGCTAGG - Intronic
963582901 3:147149140-147149162 TACCCAGCATTGGGATTGTTAGG - Intergenic
963701216 3:148629342-148629364 TACCTAGAAGTGGGATTGTTGGG - Intergenic
964507461 3:157415174-157415196 AACAGATCTGTGGGATTCTTGGG - Intronic
964652574 3:159028003-159028025 TACCTAACAGTGGGATTGCTGGG - Intronic
964781599 3:160345070-160345092 TACCTAGCAGTGGGATTGCTTGG - Intronic
965387415 3:168061444-168061466 TACCTAGGAGTGGGATTTATAGG - Intronic
965509415 3:169551685-169551707 GACCTAGCTGTGAAATTGTTGGG - Intronic
965879053 3:173366173-173366195 TACTTACATCTGGGATTCTTGGG + Intergenic
966142772 3:176774651-176774673 TACCTAGCAGTGGGATTGCTGGG - Intergenic
966315229 3:178637215-178637237 TACCTAGTAATGGGATTGTTGGG + Intronic
967604065 3:191423528-191423550 TACTGAGCAATGGGATTCTTGGG - Intergenic
967628170 3:191710391-191710413 TACCTAGTAGTGGGATTGCTGGG - Intergenic
969165818 4:5310669-5310691 TACCTAGTAGTGGGATTGTTGGG - Intronic
970212259 4:13721844-13721866 TAACTATCTCTGGGTTTCTTGGG + Intergenic
970305875 4:14732221-14732243 TACCTAGGAGTGGGATTGTTGGG + Intergenic
972081556 4:35157945-35157967 TACCAAGCAGTGGTATTGTTAGG - Intergenic
972260755 4:37406418-37406440 TACCTAGTAATGGGATTCCTGGG - Intronic
973128788 4:46623150-46623172 TACTTAGCTGAGCTATTCTTGGG + Intergenic
973215232 4:47660806-47660828 TACCTAGCAGTGGGATTGCTGGG - Intronic
973674128 4:53247369-53247391 TACCTAGTAATGGGATTCCTAGG - Intronic
973675592 4:53258738-53258760 TACCTAGTAGTGGGATTGCTGGG + Intronic
974867513 4:67598291-67598313 TACCTAGCAGTGGGATTGCTGGG + Intronic
975083941 4:70314221-70314243 TACCTATCTGTTGCATTTTTAGG - Intergenic
975107145 4:70580500-70580522 TACCTAGTAGTGGGATTGCTGGG - Intergenic
975276785 4:72511741-72511763 TACCCAGCTGTAGGATTGCTGGG - Intronic
975375583 4:73640390-73640412 TACCTAGCTGTGGGATTGCTGGG + Intergenic
975422846 4:74189561-74189583 TACATAGCAGTGGGATTGGTTGG + Intronic
976227628 4:82808664-82808686 TACCTAGCAGTGAGATTGCTGGG - Intergenic
976768376 4:88622496-88622518 TACCTAGAAGTGGAATTGTTGGG + Intronic
976775377 4:88700303-88700325 CACCTAGCAGTGGGATTGCTGGG + Intronic
976809416 4:89084633-89084655 TACCCAGCAATGGGATTTTTGGG + Intronic
976908674 4:90272537-90272559 TACCTAGCAGTGGGATACCTAGG - Intronic
977577218 4:98688025-98688047 TACCTAACAGTGGAATTGTTGGG + Intergenic
977773203 4:100883870-100883892 TACCTATCAGTGAGATTGTTGGG + Intergenic
977821930 4:101482147-101482169 TACCAAGCAGTGGGATTGCTGGG + Intronic
977975675 4:103263360-103263382 TACCTAGAAGTGGGATTGTTGGG + Intergenic
978351258 4:107823293-107823315 TACCTAGCAGTGAGATTGCTAGG + Intergenic
978465292 4:109002190-109002212 TACCCAGCTGTGGGATTGCTAGG - Intronic
978743506 4:112165383-112165405 TACCCAGCAGTGGGATTGCTAGG - Intronic
978774559 4:112492667-112492689 TACCCAGCAGTGGGATTGCTGGG - Intergenic
978985109 4:115002708-115002730 TACCTAGTAATGGGATTCCTGGG - Intronic
979184926 4:117776234-117776256 TACCTAACAGTGGGATTGCTAGG - Intergenic
979313126 4:119227724-119227746 TACCTAGCAGTGGGACTGCTAGG - Intronic
979339503 4:119504461-119504483 TACCTAGTAGTGGGATTGCTGGG + Intronic
979781809 4:124660790-124660812 TATCTAGGAGTGGGATTCCTGGG - Intergenic
980694074 4:136333493-136333515 TACCCAGCAGTGGGATTGCTGGG - Intergenic
980860792 4:138497068-138497090 TACCTAGCAGTGGGATTCACTGG + Intergenic
981582463 4:146263314-146263336 TACCAAGCTGTAAGCTTCTTAGG + Intronic
981598782 4:146460314-146460336 TACCTAGTGGTGGGATGGTTTGG - Intronic
981796648 4:148603458-148603480 TACCTAGTTGTGATATTGTTGGG - Intergenic
982797924 4:159667767-159667789 GTCCTAGCAGTGGGATTGTTGGG + Intergenic
983132205 4:164034451-164034473 TACCTAGTAGTGGGATTACTGGG - Intronic
984395430 4:179192015-179192037 TACCTAGGAGTGGGATTGCTGGG + Intergenic
986270810 5:6229041-6229063 GACCTGGCTGTGGGACTGTTGGG + Intergenic
986613401 5:9592204-9592226 AACCTAGCTGTTGGATTGATAGG + Intergenic
987334916 5:16890363-16890385 TACCTAGCAGTGGAATTTCTGGG - Intronic
987431043 5:17833378-17833400 TATCTGGCTGTGTGCTTCTTGGG + Intergenic
987790828 5:22565258-22565280 TACCTAGCAGTAGGATTGCTGGG + Intronic
987827666 5:23054637-23054659 AACTTAGTTGTGGGATTTTTTGG + Intergenic
988626344 5:32879317-32879339 TACCTAGCATTGGGATTGCTGGG - Intergenic
989553722 5:42766394-42766416 TACCCAGCAGTGGGATTGCTGGG - Intronic
989658903 5:43777070-43777092 TACCCAGCAGTGGGATTGCTGGG + Intergenic
989788798 5:45365701-45365723 TACCAAGCAGTGGGATTACTGGG + Intronic
990294613 5:54387964-54387986 TACTCAGCTGTGGGTCTCTTGGG + Intergenic
990713522 5:58610252-58610274 TCCCTAGGAGTGGGATTGTTAGG + Intronic
990854232 5:60245412-60245434 TACCTAGGAGTGGGATTGCTGGG - Intronic
990864911 5:60369456-60369478 TTCCTAGCTGTGGGAGTTATTGG - Intronic
991645967 5:68800563-68800585 AATCTAGCTGTGGGATTTTAGGG + Intergenic
992000438 5:72431041-72431063 TACCTAGAAGTGGGATTGCTGGG - Intergenic
992587711 5:78258672-78258694 TACCCAGCAGTGGGATTGCTGGG - Intronic
993494457 5:88592255-88592277 TACCTAGTAATGGGATTCCTGGG - Intergenic
993646485 5:90469859-90469881 TACCCAGCAGTGGGATTGCTAGG - Intronic
994319923 5:98382370-98382392 TACCTACCAGTGGGATTGCTGGG + Intergenic
994602069 5:101918765-101918787 TAAATAGCAGTGGGATTGTTGGG + Intergenic
995167356 5:109059808-109059830 TGCCTAGTAGTGGAATTCTTAGG - Intronic
995188495 5:109296402-109296424 TACCTAGCAATGGGATTGCTGGG - Intergenic
995369239 5:111400270-111400292 TTTCTACCTGTGGAATTCTTAGG - Intronic
995758245 5:115535723-115535745 TACCTAGGAGTGGCATTATTGGG - Intronic
996033162 5:118729448-118729470 TACCTAGGTGTGGAATTGCTGGG - Intergenic
997620767 5:135291664-135291686 TACCTAGGTATGGAATTATTGGG + Intronic
997706953 5:135964655-135964677 TACTTAGCTGTGGGAATAATGGG + Intergenic
998242540 5:140461561-140461583 TAACTAGGTGATGGATTCTTAGG - Intronic
998594350 5:143512961-143512983 TACCTAGCTGTGGAATTGCTGGG + Intergenic
999518544 5:152325322-152325344 TACCCAGTAGTGGGATTCCTGGG + Intergenic
1000263095 5:159608468-159608490 TACCTAGTAATGGGATTGTTAGG - Intergenic
1000993692 5:167937386-167937408 TACCTAGACTTGGGATTATTAGG + Intronic
1001347566 5:170920171-170920193 TAGCTAGGTGTGGGATTCCTGGG + Intronic
1001374517 5:171243534-171243556 TACCTAGAAGTGGGATTTCTAGG + Intronic
1002314766 5:178336215-178336237 TACCTAGCAGTGGAATTGCTGGG - Intronic
1002545172 5:179937678-179937700 TACCTAGCAGTGGAATTGCTGGG - Intronic
1003241791 6:4351563-4351585 TACCCAGAAGTGGGATTGTTGGG + Intergenic
1003594917 6:7465898-7465920 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1004023947 6:11800532-11800554 TACCTAGGAGTGGGATTTCTGGG + Intronic
1004670896 6:17795667-17795689 TACCTATGAGTGGGATTCTTGGG + Intronic
1005528309 6:26674750-26674772 TGCCTTGCTATGGGTTTCTTTGG - Intergenic
1005542486 6:26826889-26826911 TGCCTTGCTATGGGTTTCTTTGG + Intergenic
1005595654 6:27376476-27376498 TACCTCACTGTGGTATTTTTTGG + Intronic
1006769464 6:36540392-36540414 TACCTAGGGGTGGGATTTCTGGG - Intronic
1007980881 6:46156859-46156881 TACCTAGGTGTGGATTTATTTGG + Intergenic
1008220018 6:48843906-48843928 TACCCAGCTATGGGATTGCTGGG + Intergenic
1008379976 6:50830354-50830376 TTCTTAGATGTGGGATGCTTTGG + Intronic
1008614386 6:53212076-53212098 TACCTAGCAGTGGGATTGCTGGG + Intergenic
1008694101 6:54013948-54013970 TACCTAGCAGTGGAATTTTGGGG + Intronic
1008881673 6:56386450-56386472 TACCTAGGAGTGGAATTGTTGGG + Intronic
1009013295 6:57869007-57869029 TGCCTTGCTATGGGTTTCTTTGG + Intergenic
1009044747 6:58225110-58225132 TACCTAGGAGTGGAATTGTTTGG - Intergenic
1009220562 6:60979424-60979446 TACCTAGGAGTGGAATTGTTTGG - Intergenic
1009416550 6:63421997-63422019 TATCTTCCTGTGGGTTTCTTTGG - Intergenic
1009500722 6:64409307-64409329 TACCCAGCAATGGGATTGTTGGG + Intronic
1009825476 6:68860756-68860778 TACCCAGCAGTGGGATTCCTGGG + Intronic
1009838044 6:69030244-69030266 TACCTAGCAATGGGATTGCTGGG - Intronic
1010278569 6:73997363-73997385 TACCCAGTTGTGGGATTTCTGGG + Intergenic
1010907051 6:81503516-81503538 TACCTAGCAATGGGATTGCTGGG - Intronic
1010923193 6:81710321-81710343 TACCCAGTAGTGGGATTCCTGGG + Intronic
1011013950 6:82734488-82734510 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1011021303 6:82816239-82816261 TACCTAGCAATGGGATTGCTGGG - Intergenic
1011500926 6:87989007-87989029 TACCCAGTAATGGGATTCTTGGG - Intergenic
1011908794 6:92409266-92409288 GACCTAGCTCTGGGAGTCATGGG - Intergenic
1012333586 6:98025588-98025610 TATCCAGCTGTTGGATTCTGTGG - Intergenic
1012516122 6:100061779-100061801 TACCCAGCAGTGGGATTGATGGG + Intergenic
1013236707 6:108203057-108203079 TTCCTAGAAGTGGGATTCCTGGG + Intergenic
1013423664 6:109990447-109990469 TACCTAGTAATGGGATTCCTGGG - Intergenic
1013573317 6:111452331-111452353 TACTTAGGAGTGGGATTGTTGGG - Intronic
1013663230 6:112320163-112320185 TACCTAGCAGTGGGATTGCAGGG - Intergenic
1013938064 6:115623509-115623531 TACCTAGTAGTGGGATTGCTAGG - Intergenic
1014070876 6:117180468-117180490 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1014544138 6:122713194-122713216 TACCTTGCTGTGGGATTGCAAGG + Intronic
1015479685 6:133693916-133693938 TACCTAGAAGTGGAATTATTAGG + Intergenic
1015734604 6:136385303-136385325 TACTTAGCTGATGGACTCTTAGG + Intronic
1015996120 6:138996943-138996965 TACCTAGGAGTGGGATTGTTTGG + Intergenic
1016762534 6:147754061-147754083 TACCCAGCAGTGGGATTACTGGG + Intergenic
1016816921 6:148311457-148311479 TACCTAGAAGTGGGATTGGTGGG - Intronic
1016904427 6:149134877-149134899 TTTCTGGCTGAGGGATTCTTTGG - Intergenic
1016983147 6:149871553-149871575 TACCTAGAAGTGGGATTGCTGGG + Intergenic
1017189731 6:151639872-151639894 TACCTAGGAGTGGAATTGTTAGG + Intergenic
1017220102 6:151956237-151956259 TACCCAGTAGTGGGATTCCTTGG + Intronic
1017661202 6:156675595-156675617 TACCTAGCAGTGGGATTACTGGG - Intergenic
1018513970 6:164557749-164557771 TACTTAGGTTTGGGATTGTTAGG + Intergenic
1018884235 6:167919447-167919469 TACCCAGCTAAGAGATTCTTGGG + Intronic
1019756288 7:2772767-2772789 TACCTAGGAGTGGGATTGCTGGG - Intronic
1020722939 7:11772352-11772374 TACCCAGTAATGGGATTCTTGGG - Intronic
1020928982 7:14369431-14369453 TACCTAGTAGTGGGATTACTGGG + Intronic
1021093306 7:16508135-16508157 TATCTAGCAGTGGGATTGCTGGG - Intronic
1021419189 7:20425861-20425883 TACCTAGGAGTAGGATTATTAGG + Intergenic
1021677248 7:23093554-23093576 TATCTAGGTGTGGAATTCCTGGG + Intergenic
1021736267 7:23641022-23641044 TACCTAGGAGTGGAATTCCTAGG + Intronic
1022536615 7:31102428-31102450 GTCCTAGCTGTGGGCTTCTGTGG + Intronic
1022651920 7:32285331-32285353 TTCCTAGGAGTGGGATTGTTGGG - Intronic
1022853578 7:34292769-34292791 TATCTTGCTGTGTAATTCTTTGG + Intergenic
1024145710 7:46514589-46514611 TACCTAGTAGTGGGATTGCTGGG + Intergenic
1024284541 7:47745815-47745837 TGCCTAGTAGTGGGATTCTTGGG + Intronic
1024336555 7:48212447-48212469 TACCTAGGAGTAGAATTCTTGGG + Intronic
1024961807 7:54984498-54984520 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1024999722 7:55305504-55305526 TACCCAGTTGTGAGATTCCTGGG - Intergenic
1026161902 7:67876857-67876879 TATCTAGTAGTGGGATTGTTGGG + Intergenic
1026520025 7:71109122-71109144 TCCCTAGCAGTGGAATTATTAGG - Intergenic
1027339040 7:77186121-77186143 TACCCAGCAGTGGGATTGCTTGG - Intronic
1029954453 7:104622820-104622842 TACCTAGGAGTGGGATTGCTGGG + Intronic
1030217641 7:107062153-107062175 TACCTAGGAGTGGGATTGCTTGG - Intronic
1030314641 7:108102080-108102102 TACCTAGCTGTGGAATTTCTGGG - Intronic
1030399614 7:109031992-109032014 TACCTAGTAATGGGATTGTTGGG + Intergenic
1030409674 7:109160133-109160155 TACCTAGGAGTGGAATTATTTGG - Intergenic
1030480754 7:110100964-110100986 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1031412188 7:121453037-121453059 TACCTAGCAGTGGGATTGTTGGG + Intergenic
1031472239 7:122180854-122180876 TACCTAGAAGTGGGATTGCTGGG + Intergenic
1031501093 7:122517413-122517435 TACCTAGGAGTGGGATTGTAGGG + Intronic
1031641285 7:124167577-124167599 TACCCAGTTGTGGGATTTCTGGG - Intergenic
1032482626 7:132258789-132258811 TACCCAACTCTGGGATTCTTTGG - Intronic
1032590645 7:133189018-133189040 TACCTAGGAGTGGGATTACTGGG + Intergenic
1033517229 7:142119531-142119553 TACCTAGAAGTGGAATTGTTAGG - Intronic
1033954218 7:146824398-146824420 TACCTAGTAATGGGATTGTTGGG + Intronic
1034101357 7:148453337-148453359 TACCTAGTTTTGGGATTGCTGGG - Intergenic
1034216277 7:149408729-149408751 TACCCAGCGGTGGGATTGCTAGG + Intergenic
1034388582 7:150763577-150763599 TACCTTGGAGTGGGATTGTTGGG - Intergenic
1036577039 8:10037292-10037314 TACCCACCAGTGGGATTGTTGGG + Intergenic
1036683230 8:10891392-10891414 AACATAGCTCTGGGATCCTTGGG - Intergenic
1036835087 8:12057066-12057088 TACCCAGCCGTGAGATTCCTAGG + Intergenic
1036856931 8:12303630-12303652 TACCCAGCCGTGAGATTCCTAGG + Intergenic
1037137366 8:15478792-15478814 TACCTAGTAATGGGATTCATGGG + Intronic
1037325937 8:17690513-17690535 TACCCAGCAGTGGGATTGCTGGG - Intronic
1037342192 8:17858047-17858069 TACCCAGCAGTGGGATTACTGGG - Intergenic
1037461904 8:19119139-19119161 TACCTAGAAGTGGGATTGCTGGG + Intergenic
1038001703 8:23397440-23397462 TACCTAGATATGCTATTCTTGGG + Intronic
1038093954 8:24286569-24286591 TACCTAGCTGATGGATTGATAGG + Intergenic
1038582083 8:28756604-28756626 TACCTAGGAGTGGAATTGTTGGG + Intergenic
1040436480 8:47396562-47396584 AACTTAGCTGTGGGTTTCTGAGG - Exonic
1041116774 8:54547592-54547614 TACCCAGTTATGGGATTGTTGGG - Intergenic
1041209116 8:55529616-55529638 TTCCTAGCTGTGGGACCTTTGGG - Exonic
1041961207 8:63617999-63618021 TAACTAGGAATGGGATTCTTGGG + Intergenic
1042469822 8:69173483-69173505 TATCTTGGTGTGGGTTTCTTTGG + Intergenic
1042968073 8:74377750-74377772 TACCTAAGAGTGGGATTGTTAGG - Intronic
1042981688 8:74536621-74536643 TACCTAGTAGTGGGATTGCTGGG + Intergenic
1043744520 8:83856646-83856668 TACCTAGCAGTGGGATTGCTGGG - Intergenic
1044160504 8:88908614-88908636 TACCCAGTAGTGGGATTATTTGG - Intergenic
1044879561 8:96709609-96709631 TACCTAGTAGTGGGATTGCTGGG + Intronic
1045339261 8:101237598-101237620 TACCTAGAAGTGGAATTGTTGGG + Intergenic
1045556112 8:103216272-103216294 TACCTAGGAGTGGAATTGTTGGG + Intronic
1045603402 8:103745478-103745500 TACCTAGGAGTGGAATTCCTGGG + Intronic
1045669818 8:104537726-104537748 TACCTAGTTGTGGAATTGTTAGG - Intronic
1045768706 8:105708151-105708173 TGACTAGCTCTGGGATTATTTGG + Intronic
1045958356 8:107936479-107936501 TACCCAGCAGTGGGATTACTGGG + Intronic
1046000550 8:108416027-108416049 CACCTAGGAGTGGGATTCCTGGG - Intronic
1046165665 8:110431595-110431617 TTACTAGCAGTGGGATTCCTGGG - Intergenic
1046167056 8:110450737-110450759 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1047001409 8:120576699-120576721 TTACTAGCTGTGGGGGTCTTGGG + Intronic
1049815025 8:144595071-144595093 TACCTAGTTGTGGAATTGCTGGG - Intronic
1050427590 9:5527669-5527691 TACCTAGAAGTGGGATTGCTAGG + Intronic
1051030134 9:12664601-12664623 TACCTAGCAGTGGAATTGCTGGG - Intergenic
1051170729 9:14315863-14315885 TACCTAGCTGGGGGATCCGGGGG + Intronic
1051946650 9:22577397-22577419 TACCCAGTTATGGGATTGTTGGG - Intergenic
1052314884 9:27106089-27106111 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1052583560 9:30393892-30393914 TACCTAGTAATGGGATTCCTGGG - Intergenic
1052677317 9:31644121-31644143 TACATAGGAGTGGGATTCCTGGG - Intergenic
1052877260 9:33576185-33576207 TACAGAACTGTGGGCTTCTTGGG + Intergenic
1052959657 9:34284318-34284340 TACCTAGCTGTGAAATGATTAGG - Intronic
1054821575 9:69526687-69526709 TACCCAGCAGTGGGATTGCTGGG - Intronic
1056071443 9:82991255-82991277 TACCTACTTTTGGGATTTTTAGG + Intronic
1056969213 9:91188390-91188412 TACCTGGGTGTCAGATTCTTGGG - Intergenic
1057500343 9:95592703-95592725 TACCTAGGTGTGGAATTGCTGGG - Intergenic
1057597417 9:96426768-96426790 TACCTAGGTGTGGAATTGCTGGG + Intergenic
1058529774 9:105894197-105894219 TACCTAGGTGAGGGGTTCATAGG - Intergenic
1058561531 9:106233855-106233877 TACCTACCTGTAGGATTGTTAGG + Intergenic
1058569873 9:106329390-106329412 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1060077944 9:120611224-120611246 TACCTAGGAGTGGAATTCCTGGG - Intronic
1060092361 9:120754478-120754500 TACCCAGTAGTGGGATTCCTGGG + Intronic
1060433533 9:123571810-123571832 TAGCCAGGTGTGGGATTGTTGGG + Intronic
1060840304 9:126788055-126788077 TACCTAGATGTGAAATTCCTGGG - Intergenic
1061752999 9:132793582-132793604 TAACTAGTTCTGTGATTCTTGGG - Intronic
1061845915 9:133388088-133388110 TACCTAGGAGTGGAATTATTGGG + Intronic
1185862705 X:3593988-3594010 TACCTAGTCGTGGGATTGCTGGG - Intergenic
1185967325 X:4622137-4622159 TACTGAGCAGTGGGATTCCTAGG - Intergenic
1186320087 X:8414629-8414651 TACCCAGTAGTGGGATTGTTGGG - Intergenic
1186332713 X:8552321-8552343 TCCATAGAGGTGGGATTCTTAGG - Intronic
1186393529 X:9184701-9184723 TACCTAGGAGTGGCATACTTGGG - Intergenic
1186399929 X:9248332-9248354 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1186499143 X:10037232-10037254 TACCTAGGTGTTGGATTGCTGGG + Intronic
1186782295 X:12925081-12925103 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1187177751 X:16911962-16911984 TATCTAGCAGTTGGATTTTTGGG + Intergenic
1187615314 X:20987408-20987430 TACCCAGTAGTGGGATTCCTGGG - Intergenic
1187843965 X:23516997-23517019 TACCCAGCAGTGGGATACCTGGG + Intergenic
1187845375 X:23531046-23531068 TACCCAGCAGTGGGATACCTGGG - Intergenic
1187943501 X:24404139-24404161 TACCTAGAAGTGGGATTGGTGGG + Intergenic
1188657917 X:32721216-32721238 TACCCAGGAGTGGGATTGTTGGG + Intronic
1188971718 X:36625532-36625554 TACATAGCAGTGGGATTGATGGG + Intergenic
1189403495 X:40694827-40694849 TAACTAGGAGTGGGATTATTGGG - Intronic
1189866094 X:45328862-45328884 AACCTAGCTATTGCATTCTTGGG - Intergenic
1190462909 X:50696391-50696413 TTCCTAGCTGTGTGACCCTTAGG + Intronic
1190602532 X:52107551-52107573 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1190821595 X:53978287-53978309 TACCTAGGAATGGGATTCCTGGG - Intronic
1190995202 X:55601042-55601064 TACCCAGTAGTGGCATTCTTGGG + Intergenic
1191102091 X:56741353-56741375 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1192045380 X:67666570-67666592 TACCCAGCAGTGGGATTGCTGGG + Intronic
1192230847 X:69263975-69263997 TACCTAGAAGTGGGATTTCTCGG - Intergenic
1192629384 X:72764122-72764144 TACCCAGCAGTGGGATTGCTGGG - Intergenic
1192652326 X:72956692-72956714 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1192805832 X:74508006-74508028 TATCTAGCAGTGGGATTGCTGGG + Intronic
1192845265 X:74900642-74900664 TACCCAGAAGTGGGATTGTTGGG - Intronic
1192899817 X:75484695-75484717 TACCTAGCTGTGGGATTCTTGGG - Intronic
1193563095 X:83043989-83044011 TAGCTATCAGTGGGATTGTTGGG + Intergenic
1193618721 X:83724018-83724040 TACCCAGTTGTGGGATTGCTGGG + Intergenic
1193883395 X:86955087-86955109 TACCCAGCAGTGGGATTGCTAGG - Intergenic
1194697136 X:97067013-97067035 TACCTTTCTGTGGGATGCCTTGG + Intronic
1194702284 X:97129008-97129030 TACCTAGGAGTGGGAATCCTGGG + Intronic
1194868696 X:99100774-99100796 TACCTAGGAATGGGATTCCTGGG - Intergenic
1194939752 X:99995412-99995434 TACCCAGCAGTGGGATTGCTGGG + Intergenic
1195247355 X:103006378-103006400 AACCTAGGTGTGGGCTCCTTTGG + Intergenic
1195547651 X:106130998-106131020 TACCCAGCAGTGGGATTGTTGGG - Intergenic
1195774303 X:108386230-108386252 TACCCAGCAATGGGATTCCTGGG + Intronic
1195949471 X:110252616-110252638 TACCTAGATGTGAAATTATTTGG - Intronic
1196091306 X:111746696-111746718 TACCTAGCAGTGGAATTGCTGGG + Intronic
1196336413 X:114541567-114541589 TACCTAGGAGTGGAATTGTTGGG - Intergenic
1196383142 X:115116183-115116205 TACCTAGCAGTGAAATTGTTAGG - Intronic
1196565620 X:117201169-117201191 TACCCAGTAGTGGGATTCCTGGG + Intergenic
1196567038 X:117220174-117220196 TACCTATGTATGGGATTCATAGG - Intergenic
1196750506 X:119112822-119112844 TACCTAGGAGTGGAATTGTTGGG - Intronic
1197100678 X:122650668-122650690 TACCTAGCAGTAGGATTGCTAGG - Intergenic
1197185789 X:123586199-123586221 TACCTAGAAGTGGGATTCATGGG + Intergenic
1197394975 X:125916107-125916129 TACCCAGTAGTGGGATTCCTAGG + Intergenic
1197412384 X:126134859-126134881 TACCTAGTAATGGGATTATTGGG + Intergenic
1197518163 X:127462642-127462664 TACCCAGATATGGGATTCCTGGG - Intergenic
1198562084 X:137861292-137861314 TAACCAGCAGTGGGATCCTTGGG + Intergenic
1198659449 X:138951860-138951882 TACCTAGATGTGGATTTCCTGGG - Intronic
1199017883 X:142840572-142840594 TATCCAGCAGTGGGATTGTTGGG + Intergenic
1199299950 X:146201478-146201500 TATCTAGATGTGGGATTGCTGGG + Intergenic
1199395755 X:147335952-147335974 TGCCTAGTTGTGGATTTCTTTGG - Intergenic
1199611328 X:149617655-149617677 TACCTAGGTGTGGGATTGCTGGG - Intronic
1199824262 X:151482578-151482600 TACCTAGGAGTGGGATTGCTGGG - Intergenic
1201725575 Y:17147011-17147033 TACCCAGCTGTGGGATTGCTGGG - Intergenic
1202069471 Y:20975792-20975814 AACCTAGGTGTTGGATTCATAGG + Intergenic