ID: 1192907456

View in Genome Browser
Species Human (GRCh38)
Location X:75566778-75566800
Sequence GAGCCCACCACAACTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192907456_1192907464 26 Left 1192907456 X:75566778-75566800 CCTCCTTTAGTTGTGGTGGGCTC No data
Right 1192907464 X:75566827-75566849 TTGTTTACCTAAGCAAGCCTGGG 0: 1960
1: 1038
2: 682
3: 307
4: 179
1192907456_1192907459 -2 Left 1192907456 X:75566778-75566800 CCTCCTTTAGTTGTGGTGGGCTC No data
Right 1192907459 X:75566799-75566821 TCCACCCAGTTCAAGCTTCTGGG 0: 10
1: 341
2: 2234
3: 1842
4: 952
1192907456_1192907458 -3 Left 1192907456 X:75566778-75566800 CCTCCTTTAGTTGTGGTGGGCTC No data
Right 1192907458 X:75566798-75566820 CTCCACCCAGTTCAAGCTTCTGG 0: 17
1: 133
2: 121
3: 72
4: 163
1192907456_1192907463 25 Left 1192907456 X:75566778-75566800 CCTCCTTTAGTTGTGGTGGGCTC No data
Right 1192907463 X:75566826-75566848 TTTGTTTACCTAAGCAAGCCTGG 0: 1980
1: 1027
2: 323
3: 107
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192907456 Original CRISPR GAGCCCACCACAACTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr