ID: 1192924651

View in Genome Browser
Species Human (GRCh38)
Location X:75742875-75742897
Sequence CTGGTGTACTGGGGCAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192924647_1192924651 -6 Left 1192924647 X:75742858-75742880 CCAAGGGTGTATATATGCTGGTG No data
Right 1192924651 X:75742875-75742897 CTGGTGTACTGGGGCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192924651 Original CRISPR CTGGTGTACTGGGGCAAACC TGG Intergenic
No off target data available for this crispr