ID: 1192931569

View in Genome Browser
Species Human (GRCh38)
Location X:75811781-75811803
Sequence CAGGAAGCTTAAAATTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192931569_1192931574 13 Left 1192931569 X:75811781-75811803 CCATCATAATTTTAAGCTTCCTG No data
Right 1192931574 X:75811817-75811839 CAGGCTTCCTGTACAGCTTGTGG No data
1192931569_1192931572 -6 Left 1192931569 X:75811781-75811803 CCATCATAATTTTAAGCTTCCTG No data
Right 1192931572 X:75811798-75811820 TTCCTGTGGCATACACAGGCAGG No data
1192931569_1192931571 -10 Left 1192931569 X:75811781-75811803 CCATCATAATTTTAAGCTTCCTG No data
Right 1192931571 X:75811794-75811816 AAGCTTCCTGTGGCATACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192931569 Original CRISPR CAGGAAGCTTAAAATTATGA TGG (reversed) Intergenic
No off target data available for this crispr