ID: 1192934990

View in Genome Browser
Species Human (GRCh38)
Location X:75849954-75849976
Sequence AAAAATGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192934990_1192934992 4 Left 1192934990 X:75849954-75849976 CCCATATCATTATCAGCATTTTT No data
Right 1192934992 X:75849981-75850003 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580
1192934990_1192934994 7 Left 1192934990 X:75849954-75849976 CCCATATCATTATCAGCATTTTT No data
Right 1192934994 X:75849984-75850006 CCATTCAACAAGTCTCTAGGCGG 0: 131
1: 141
2: 110
3: 60
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192934990 Original CRISPR AAAAATGCTGATAATGATAT GGG (reversed) Intergenic
No off target data available for this crispr