ID: 1192934990

View in Genome Browser
Species Human (GRCh38)
Location X:75849954-75849976
Sequence AAAAATGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192934990_1192934992 4 Left 1192934990 X:75849954-75849976 CCCATATCATTATCAGCATTTTT No data
Right 1192934992 X:75849981-75850003 AAGCCATTCAACAAGTCTCTAGG No data
1192934990_1192934994 7 Left 1192934990 X:75849954-75849976 CCCATATCATTATCAGCATTTTT No data
Right 1192934994 X:75849984-75850006 CCATTCAACAAGTCTCTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192934990 Original CRISPR AAAAATGCTGATAATGATAT GGG (reversed) Intergenic