ID: 1192939639

View in Genome Browser
Species Human (GRCh38)
Location X:75899509-75899531
Sequence CAGAATTAGGAGAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192939639_1192939644 -8 Left 1192939639 X:75899509-75899531 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1192939644 X:75899524-75899546 TAATTCTGGTGCCCAAGTGAGGG No data
1192939639_1192939647 26 Left 1192939639 X:75899509-75899531 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1192939647 X:75899558-75899580 TCCAGCTGAGTGCTAGTTCCTGG No data
1192939639_1192939643 -9 Left 1192939639 X:75899509-75899531 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1192939643 X:75899523-75899545 CTAATTCTGGTGCCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192939639 Original CRISPR CAGAATTAGGAGAAGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr