ID: 1192939643

View in Genome Browser
Species Human (GRCh38)
Location X:75899523-75899545
Sequence CTAATTCTGGTGCCCAAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192939639_1192939643 -9 Left 1192939639 X:75899509-75899531 CCTTTTTCCTTCTCCTAATTCTG No data
Right 1192939643 X:75899523-75899545 CTAATTCTGGTGCCCAAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192939643 Original CRISPR CTAATTCTGGTGCCCAAGTG AGG Intergenic
No off target data available for this crispr