ID: 1192940372

View in Genome Browser
Species Human (GRCh38)
Location X:75904933-75904955
Sequence TGACAAACAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192940367_1192940372 13 Left 1192940367 X:75904897-75904919 CCAGAGGGATGGAAGTCAGTGGC No data
Right 1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192940372 Original CRISPR TGACAAACAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr