ID: 1192941244

View in Genome Browser
Species Human (GRCh38)
Location X:75913714-75913736
Sequence CAATTATTGCAGAAGGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192941240_1192941244 -9 Left 1192941240 X:75913700-75913722 CCTCCAGAAATTTACAATTATTG No data
Right 1192941244 X:75913714-75913736 CAATTATTGCAGAAGGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192941244 Original CRISPR CAATTATTGCAGAAGGTGAA GGG Intergenic
No off target data available for this crispr