ID: 1192942101

View in Genome Browser
Species Human (GRCh38)
Location X:75923282-75923304
Sequence CAGGGCAATCAGGAAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192942093_1192942101 12 Left 1192942093 X:75923247-75923269 CCACTCCTATTCAACATAAAGTT No data
Right 1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG No data
1192942092_1192942101 21 Left 1192942092 X:75923238-75923260 CCTCTCTCACCACTCCTATTCAA 0: 10545
1: 6573
2: 4267
3: 3542
4: 3345
Right 1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG No data
1192942095_1192942101 7 Left 1192942095 X:75923252-75923274 CCTATTCAACATAAAGTTGGAAG No data
Right 1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG No data
1192942091_1192942101 22 Left 1192942091 X:75923237-75923259 CCCTCTCTCACCACTCCTATTCA 0: 10185
1: 5655
2: 3179
3: 2674
4: 3101
Right 1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192942101 Original CRISPR CAGGGCAATCAGGAAGAAGA AGG Intergenic
No off target data available for this crispr