ID: 1192944520

View in Genome Browser
Species Human (GRCh38)
Location X:75950443-75950465
Sequence CCTTCTACATGGGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192944512_1192944520 23 Left 1192944512 X:75950397-75950419 CCTTTGTACCTTAATTGAAGATC No data
Right 1192944520 X:75950443-75950465 CCTTCTACATGGGAGCTGCAGGG No data
1192944514_1192944520 15 Left 1192944514 X:75950405-75950427 CCTTAATTGAAGATCAGGAATTC No data
Right 1192944520 X:75950443-75950465 CCTTCTACATGGGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192944520 Original CRISPR CCTTCTACATGGGAGCTGCA GGG Intergenic
No off target data available for this crispr