ID: 1192947620

View in Genome Browser
Species Human (GRCh38)
Location X:75983156-75983178
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192947617_1192947620 16 Left 1192947617 X:75983117-75983139 CCTTTGGGAGAAAGGTAGGCTAT No data
Right 1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192947620 Original CRISPR GTTGAAACACAGAGGCCTAT GGG Intergenic
No off target data available for this crispr