ID: 1192958257

View in Genome Browser
Species Human (GRCh38)
Location X:76096140-76096162
Sequence GAGGGTAAGCAGAAGCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192958257_1192958267 24 Left 1192958257 X:76096140-76096162 CCATCCTGCTTCTGCTTACCCTC No data
Right 1192958267 X:76096187-76096209 CAGTCCCAAAGAGATGAGCTGGG No data
1192958257_1192958266 23 Left 1192958257 X:76096140-76096162 CCATCCTGCTTCTGCTTACCCTC No data
Right 1192958266 X:76096186-76096208 TCAGTCCCAAAGAGATGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192958257 Original CRISPR GAGGGTAAGCAGAAGCAGGA TGG (reversed) Intergenic
No off target data available for this crispr