ID: 1192963799

View in Genome Browser
Species Human (GRCh38)
Location X:76156417-76156439
Sequence GTTGGCCAAGCTGAGCTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192963799_1192963800 -8 Left 1192963799 X:76156417-76156439 CCGGGAAGCTCAGCTTGGCCAAC No data
Right 1192963800 X:76156432-76156454 TGGCCAACTACGTAACACTGTGG No data
1192963799_1192963803 9 Left 1192963799 X:76156417-76156439 CCGGGAAGCTCAGCTTGGCCAAC No data
Right 1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG No data
1192963799_1192963802 2 Left 1192963799 X:76156417-76156439 CCGGGAAGCTCAGCTTGGCCAAC No data
Right 1192963802 X:76156442-76156464 CGTAACACTGTGGCTATTTGAGG No data
1192963799_1192963804 25 Left 1192963799 X:76156417-76156439 CCGGGAAGCTCAGCTTGGCCAAC No data
Right 1192963804 X:76156465-76156487 AAAGTGGTGATTTTGAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192963799 Original CRISPR GTTGGCCAAGCTGAGCTTCC CGG (reversed) Intergenic
No off target data available for this crispr