ID: 1192963801

View in Genome Browser
Species Human (GRCh38)
Location X:76156435-76156457
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192963801_1192963805 26 Left 1192963801 X:76156435-76156457 CCAACTACGTAACACTGTGGCTA No data
Right 1192963805 X:76156484-76156506 GAGGACTACATTGCCTTCTCAGG No data
1192963801_1192963804 7 Left 1192963801 X:76156435-76156457 CCAACTACGTAACACTGTGGCTA No data
Right 1192963804 X:76156465-76156487 AAAGTGGTGATTTTGAAGAGAGG No data
1192963801_1192963803 -9 Left 1192963801 X:76156435-76156457 CCAACTACGTAACACTGTGGCTA No data
Right 1192963803 X:76156449-76156471 CTGTGGCTATTTGAGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192963801 Original CRISPR TAGCCACAGTGTTACGTAGT TGG (reversed) Intergenic
No off target data available for this crispr